YLE Tiedeuutiset

Subscribe to YLE Tiedeuutiset feed
Yle Uutiset | Tuoreimmat uutiset
Updated: 1 hour 8 min ago

Torilla tavataan! Arkeologit etsivät jälkiä Senaatintorin historiasta

8 hours 1 min ago
Torin valaisinpylväiden uusiminen antaa mahdollisuuden tieteellisiin tutkimuksiin.

Ihmiset tietovisassa piessyt tekoäly voisi pelastaa nuoria syrjäytymiseltä – vievätkö algoritmit lääkäreiden leivän vai tuovatko ne helpotuksia elämään?

12 hours 45 min ago

Lääkäri aina taskussa, kristallipalloja sairaanhoitoon, ihmistä parempia diagnostikkoja ja superalgoritmeja, jotka kertovat saatko diabeteksen vai et.

Tämä voi olla todellisuutta terveydenhuollossa jo tällä vuosikymmenellä, kun tekoälysovellukset saadaan käytäntöön.

Tekoälyn voisi määritellä koneen kyvykkyydeksi matkia ihmistä – kuunnella ja ymmärtää puhetta, hahmottaa kuvia, tunnistaa kasvoja, oppia näkemästään ja kokemastaan.

Ulkoasultaan tekoäly voidaan pukea moneen kuoreen. Se voi ilmentää itseään tietokoneohjelmana, työkaluna tai vaikkapa robottina.

Koneoppiminen on algoritmien kykyä hahmottaa erilaisia päätelmiä suurista aineistoista, havaita korrelaatioita ilmiöiden välillä tai nähdä jotain sellaista, jota inhimillisyyden kahlitsema ihminen ei näe.

Tehokkaat sovellukset voivat käydä nopeasti läpi datamääriä, joiden kahlaamisessa ihmiseltä kuluisi viikkoja, kuukausia, vuosia, jopa elinikä tai enemmän.

Algoritmit voivat olla tulevaisuudessa yhtä kiinteä osa terveydenhoitoa kuin lääkkeet tai laboratoriokokeet.

Miltä tuntuisi, jos lääkäri määräisi potilaalle verikokeiden lisäksi kolme algoritmia, jotka kahlaisivat hänen terveystietonsa läpi ja vertaisivat niitä massadatan kertomiin korrelaatiohin?

Aalto-yliopiston Arvi-robotti vuonna 2015. Koneoppimisen soveltaminen ohjelmointiin mahdollistaa roboteille kyvyn oppia jatkuvasti.Salla Hongisto / Yle

Ylen haastattelema tohtori Tanuj Gupta vetää tekoälyyn keskittyvää kehitysyksikköä Cernerissä, joka on maailman suurimpia terveydenhuollon teknologiaratkaisuja tarjoavia yrityksiä.

Koska tekoälyn vallankumous myös terveydenhuollossa on väistämätön – ainakin, jos maailma jatkaa nykyisillä raiteillaan – neuvoo Gupta miettimään jo etukäteen sääntelyä tulevan teknologian suhteen.

Gupta toivoo, että Suomessa keskusteltaisiin lainsäädännöstä näiden sovellusten suhteen jo etukäteen. Niin, että tiedettäisiin, käsitelläänkö algoritmien kliinisiä kokeita samanveroisina kuin lääkekokeita.

Vai tuliskiko digitaalisista hoitokokeista omat säädöksensä?

– Jos Suomen hallitus käsittelisi aihetta, säätäisi ohjeet ja säännöt toiminnalle, voisi se avata kokonaan uuden teollisuudenalan terveydenhoidolle, Gupta sanoo.

Tekoäly voisi tehdä terveydenhoidosta jopa ihmisläheisempää

Sana robotti tulee tšekin kielen sanasta robota, joka tarkoittaa pakkotyötä. Tekoälykin tekee sen, mitä siltä toivotaan, vaatimatta sen enempää. Se on vain työkalu.

Kun teknologia kehittyi aina Kehruu-Jennystä suurten tehtaiden ja loputtomien liukuhihnojen uupumattomiin hitsaajarobotteihin asti, pidätteli moni tehdästyöläinen hengitystään. Nyt lähtee työpaikka alta.

Tekoälyn asiantuntija, Jyväskylän yliopiston professori Pekka Neittaanmäki kertoo, että myös suomalainen lääkärikunta on osoittanut huolensa aiheesta.

Etenkin radiologit olivat Neittaanmäen mukaan huolestuneita. Jos kone kerran on minua parempi katsomaan kuvia, mihin minua tarvitaan?

Cernerin Guptan mukaan aihetta huoleen ei kuitenkaan ole.

– Sellaista algoritmia ei tulla kehittämään, joka työkaluun tai koneeseen ohjelmoituna hoitaisi potilasta mielivaltaisesti ilman lääkärin valvontaa. Ja kaikille algoritmeille, jotka tekevät tutkijalle näkymättömiä päätöksiä, pitäisi hakea luvat kliiniseen tutkimukseen.

Leikkausrobotti suorittamassa ensimmäistä sydänleikkaustaan Anhuin yliopistosairaalassa Kiinassa vuonna 2017.AOP

Myös Neittaanmäki korostaa ihmisen tärkeyttä jatkossakin. Esimerkiksi leikkausrobotitkaan eivät toimi itsenäisesti, vaan ne ovat vain työkaluja, joita ihminen käyttää.

Tekoäly voi tuoda lääkärin jopa lähemmäs potilasta. Cernerin kehittämä algoritmi kuuntelee lääkärin ja potilaan keskustelua, ymmärtää luonnollista kieltä ja poimii talteen terveystietoja, jottei lääkärin tarvitse tehdä samalla muistiinpanoja.

Siis jos potilas antaa luvan keskustelun kuuntelemiseen. Yksityisyydesta huolehtiminen on tärkeää silloinkin, kun terveydenhuoltoa avustetaan tekoälyllä.

Silloin lääkäri ehtii katsomaan silmiin useammin, olemaan enemmän läsnä tilanteessa. Ihmisen tärkein on kokonaisvaltainen hoidon arviointi ja empatia, siihen algoritmi ei taivu.

Monimutkainen tekoäly voidaan tarjoilla helpossa paketissa

Luonnollisen kielen ymmärtäminen on tärkeä ominaisuus terveydenhuoltosovellukselle.

Neittaanmäki mainitsee, että vaikkapa diagnostiikassa potilaan tapa kuvailla oireitaan on tärkeä osa johtopäätöksen tekemistä.

Teknologiajätti IBM:n Watson-tekoäly on taitava ymmärtämään luonnollista kieltä. Se murskasi ihmisvastustajansa Jeopardy-tietovisassa jo vuonna 2011.

Watsonia on sittemmin käytetty esimerkiksi mainonnassa ja myös kullankaivuussa. Watsonin käyttömahdollisuuksia on testattu Suomessakin.

Tämä verinäytteitä analysoiva robottimikrobiologi kantaa kortensa kekoon taistelussa koronaa vastaan. Pandemia on lisännyt kiinnostusta terveydenhuollon uutta teknologiaan kohtaan. Evgenii Parilov / Alamy

Taitava tekoäly voisi Neittaanmäen mukaan esimerkiksi tunnistaa syrjäytymisvaarassa olevia nuoria ynnäämällä yhteen ennusmerkkejä.

Jyväskylän yliopiston Tekoälyn soveltaminen terveydenhuollossa ja hyvinvoinnissa -raportti esittelee lukuisia kansallisen tason käyttökohteita, joihin tekoäly voisi sopia.

Tekoälystä voisi tulla esimerkiksi virtuaalinen perhelääkäri, joka tuntisi perheen terveystiedot perinpohjaisesti ja osaisi konsultoida hoitoa.

Helppo mobiilisovellus voisi tunnistaa kasvoista ja puheesta aivohalvauksen oireet.

Tekoäly on monimutkainen konsepti, mutta sen sovellukset voivat olla hyvinkin ihmisläheisiä.

Antaisitko sinä terveystietosi tekoälylle?

Yksi pulma koneoppimisen hyödyntämisessä on pitkään ollut se, että algoritmit vaativat massiivisesti dataa oppiakseen itsenäisesti.

Lapsi oppii nopeasti, miltä koira näyttää. Sillä on karvaa, häntä, korvat ja se haukkuu. Algoritmille saman asian oppiminen vaatii lukuisia toistoja, sillä se ei varsinaisesti näe, vaan tarkastelee kuvien pikseleitä.

Kun koirien kuvia on näytetty tarpeeksi, saattaa sovellus kinnittää huomiota myös sellaisiin ominaisuuksiin, joihin ihminen ei osaisi. Inhimillisyys ei ohjaa sen hahmotuskykyä.

Professori Pekka Neittaanmäen mukaan algoritmit eivät enää ole yhtä vaativia datamäärien suhteen, sillä ihminen pystyy opettamaan niille, miten pienempiä data-annoksia kuuluisi tarkastella.

Tanuj Guptan mukaan osaan Cernerin visioimista sovelluksista dataa on jo nyt riittävästi saatavilla, osaan ei.

Ongelmana on terveystietojen yksityisyys, joka on toisaalta hyvin ymmärrettävää yksilönsuojelun näkökulmasta.

Jos terveystiedot olisivat julkisia, uhkana olisi syrjintä niiden perusteella. Vaikuttaisiko työntekijän masennus mahdollisuuksiin edetä uralla? Saisiko kaksisuuntaista mielialahäiriötä sairastava asunnon?

1997 IBM:n Deep Blue -tietokone voitti shakkiottelun maailmanmestari Garri Kasparovia vastaan. Viimeistään tästä alkoi ison datan vallankumous, joka on tuonut koneoppimisen osaksi elämäämme.Copyright Rex Features Ltd 2012/All Over Press

Terveysdata eroaakin esimerkiksi sosiaalisen median datasta.

Kun käytämme Facebookia tai Googlen sovelluksia, annamme luvan sille, että meistä kerättyjä tietoja, siis dataa, voidaan käyttää algoritmien kehittämiseen yhtiöiden sisällä.

Silloin käyttäjädataa saadaan kerättyä suunnattomia määriä.

Myös terveydenhuollolla dataa on paljon, mutta se ei ole julkista. Edes Cerner, joka kehittää koneoppimisen sovelluksia terveydenhuoltoon, ei voi yhdistää kaikkien asiakkaidensa dataa kaikista terveystiedoista.

Jotkut sairaudet ovat myös niin harvinaisia, ettei kaikki maailman terveysdata riittäisi siihen, että algoritmit saataisiin toimimaan luotettavasti.

Vielä vuonna 2012 Googlen Gmail-sähköpostiin rekisteröityessä annettiin lupa vain siihen, että Gmail saa käyttäjän tiedot.

Nykyisin lupa koskee yhtiön kaikkia sovelluksia. Datan keräämistä on vastustettu, mutta asenneilmapiiri on muuttunut, kun sovellukset puhuvat keskenään ja voivat tehdä elämästä helpompaa.

Suhtautuminen siihen, että Cernerin kaltaiset yhtiöt saisivat jatkuvan käyttöoikeuden terveystietoihin, on kuitenkin yhä kankeaa.

Vallankumous on jo täällä

Terveydenhuollon digitalisaation ensimmäinen askel olivat sähköiset potilastietojärjestelmät.

Ne ottivat hiljalleen jalansijaa terveydenhuollon eri aloilla, kunnes 2000-luvulla tietojen tallennuksesta tuli kokonaan sähköistä.

Sähköisistä järjestelmistä on tullut itsestäänselvyys, mutta Gutpan mukaan vielä 20 vuotta sitten lääkärit ja hoitajat toppuuttelivat kehitystä, sillä homma toimi hyvin paperillakin.

Paperilta verkkoon, kirjoituskoneista digitaalisuuteen kiipeäminen oli yli kahden vuosikymmenen taival.

Kannustavat esimerkit tekoälyn hyödyllisyydestä ovat kääntäneet suhtautumisen päälaelleen.

Kysyntää sovelluksille on valtavasti, ja Gupta uskoo, että se tulee vauhdittamaan aikataulua, jossa koneoppivista algoritmeista tulee todellisuutta arkipäivän terveydenhuollossa.

Siksi Gupta arvioi, että tekoäly mullistaa jo tällä vuosikymmenellä terveydenhuollon.

Pandemia vauhdittaa terveydenhuollon kristallipallon kehittämistä

Seuraavat sovellukset, jotka näkevät päivänvalon, ovat todennäköisesti henkilöstön- ja resurssienhallintaan liittyviä.

COVID-19-pandemia on lisännyt ennakoinnin tarvetta ja koneoppiminen voisi auttaa siinä.

Monissa tapauksissa lääkärikäynnit on myös korvattu etävastaanotoilla.

Gupta uskoo, että jos kehitys jatkuu, tarvitaan tekoälysovelluksia myös etähoidon tarpeisiin.

Joskus ne voivat olla yllättävänkin yksinkertaisia. Tiedejulkaisu Science kertoi kesäkuussa tekoälysovelluksesta, joka analysoi verkossa tehtävän, yksinkertaisen näkötestin tuloksia.

Puolalainen 3D-ohjelmoija Wojciech Wojtkowski kehitti vuonna 2016 algoritmin, jonka avulla tehdään avaruudellisia malleja kehon elimistä. 3D-tulostetulla mallilla lääkärit voivat harjoitella leikkausta etukäteen. Tomasz Waszczuk / EPA

Jos algoritmit saataisiin arvioimaan koronatilanteen kehitystä, tiedettäisiin viikon varoitusajalla, milloin tehohoito kuormittuu ja välineistöä ja työvoimaa tarvitaan enemmän.

Samat algoritmit olisivat hyödyllisiä jatkossakin. Ne voisivat maailmantilaa tarkastelemalla ennustaa tarpeita terveydenhuollossa.

Jos huomenna sataa lunta, ihmiset liukastelevat ja sairaaloihin tulee enemmän potilaita, joilla on luunmurtumia. Jos ulkona paistaa auriko, tulee nestehukkatapauksia.

Tämän kaltaiset esimerkit ihmiset toki ymmärtävät itsekin, mutta algoritmit voivat tunnistaa korrelaatioita, joita me emme näe.

Ennustaminen, tai siis oikeastaan vain ennusmerkkien tulkitseminen, olisi yksi koneoppimisen keskeisistä käyttömahdollisuuksista terveydenhuollossa.

Lopulta kaikki riippuisi yhä ihmisestä, joka tekisi päätökset ja kantaisi vastuun hoidosta.

Osaltaan vastuuta kantaisi myös algoritmin kehittäjä, jos näin päätetään säätää, kun tekoälyn potilasturvallisuutta lähdetään tarkastelemaan lainsäädännössä.

Tekoäly, koneoppiminen ja algoritmit ovat vain työkaluja. Kuten vaikkapa kirjat, skalpellit tai sydämentahdistimet.

Ilman ihmistä niitä ei olisi, ja ilman ihmistä ne eivät toimi.

Lue myös:

Tekoäly päihitti lääkärit rintasyövän tunnistamisessa

Tekoäly voi mullistaa syövän hoitoa – Kasvain saatetaan havaita uusilla menetelmillä entistä pienempänä

Tekoäly nopeuttaa diagnooseja ja ohjaa yksilöllisempään hoitoon terveydenhoidossa – kone kertoo jo uniapneapotilaan voinnista etänä

Supertietokone ennakoi koronaviruksen käyttäytymistä – Kajaanissa selvitetään leviääkö virus vai heikkeneekö se

RS-virus on yleisin pienen vauvan sairaalaan joutumisen syy Suomessa – tautiin yritetään kehittää rokotetta, myös suomalaisäitejä haetaan mukaan

Fri, 25/09/2020 - 18:20

Tavanomaisin syy, minkä vuoksi pieni vauva joutuu Suomessa sairaalaan, on meillä talvikuukausina esiintyvä pisaratartunnan kautta leviävän RS-viruksen aiheuttama hengityselininfektio.

Etenkin alle puolivuotiailla tämä RS-viruksen (RSV) aiheuttama pienten keuhkoputkien tulehdus eli bronkioliitti voi olla vakava, koska se kerryttää paksua limaa keuhkoputkiin aiheuttaen hengitysvaikeuksia ja hengityskatkoksia, kertoo lastenlääkärinä Helsingin ja Uudenmaan sairaanhoitopiirin (HUSin) Uudessa lastensairaalassa työskentelevä lastenlääkäri, RSV-tutkija Santtu Heinonen.

– Kehitysmaissa sairauden aiheuttama suuri lapsikuolleisuus ja kehittyneissä maissa sen aiheuttama tautitaakka ja tehohoidon tarve ovat antaneet pontta kehittää vauvoja RS-virukselta suojaavaa rokotetta, kertoo rokotetutkimustiimissä mukana oleva Heinonen.

Hän uskoo, että viiden vuoden sisällä nyt kehitteillä ja testausvaiheessa olevista rokotteista ainakin yksi olisi jo käytössä.

Suurin osa sairaalaan joutuneista RSV-potilaista on perusterveitä

Vaikka keskosena syntyminen ja tietyt perussairaudet lisäävät vakavan taudin riskiä, niin suurin osa sairaalahoitoon johtaneista RSV-infektioista todetaan perusterveillä vauvoilla.

– Lähes kaikki lapset sairastavat RSV–infektion kahden vuoden ikään mennessä. Infektion voi sairastaa montakin kertaa, mutta ensimmäinen infektio on yleensä rajuoireisin, Heinonen sanoo.

Lastenlääkäri Santtu Heinosen mukaan rokotekehitys on edennyt ja kliinisissä tutkimuksissa on tällä hetkellä yli 20 RSV-rokotetta tai vasta-ainetta.Markku Pitkänen / Yle

Vanhemmilla lapsilla ja aikuisväestössä virus aiheuttaa usein limaisen flunssan ja joskus astman kaltaisia oireita.

– RSV:tä vastaan ei toistaiseksi ole olemassa rokotetta eikä tehokasta lääkitystä. Sairaalaan päätyneiden vauvojen hoidon kulmakivenä on hyvä perushoito, nesteytyksestä huolehtiminen ja hengityksen tukeminen tarvittaessa lisähapella ja erilaisilla hengitystukimuodoilla. Lisäksi hengitystä voidaan helpottaa ylähengitysteiden limaimuilla, lastenlääkäri kuvailee.

Vakavammin sairaita ja tehohoidossa olevia vauvoja yritetään auttaa lisäksi lääkityksellä, kuten keuhkoputkia avaavilla ja hengitystä helpottavilla salbutamolisulfaatilla tai adrenaliinilla.Lääkityksen teho RSV:n aiheuttamassa taudissa ei kuitenkaan ole selkeä.

RS-virus pähkinänkuoressa
  • RS-virus (lat. respiratory syncytial) leviää pisaratartuntana. Itämisaika on yleensä 4–5 päivää, jonka jälkeen alkavat oireet.
  • RS-virusta esiintyy Suomessa erityisesti talvikuukausina, osassa maailmaa ympäri vuoden.
  • Suurimmassa riskissä tartunnalle ja vakavalle taudille ovat pienet, alle 6kk ikäiset vauvat.
  • Vauvoille RS-virus aiheuttaa hengitystieinfektio-oireita joiden vaikeus vaihtelee tavallisesta flunssasta sairaalahoitoa vaativaan hengitysteitä ahtauttavaan pienten keuhkoputkien tulehdukseen (bronkioliittiin).
  • RS-virus aiheuttaa lievempiä, usein limaisen flunssan kaltaisia oireita myös aikuisväestölle.

Lähde: Rokotetutkimus.fi

RS-viruksen yleinen jälkitauti on korvatulehdus, joskin keuhkokuumekin on mahdollinen. Myös astmaoireiden puhkeamisesta myöhemmällä iällä on viitteitä.

– Jos halutaan peilata tautia koronaviruksen aiheuttamaan infektioon, tavanomaisena talvena RSV vie 200-300 lasta sairaalahoitoon, kun koronan vuoksi alle 10 lasta on toistaiseksi tarvinnut Suomessa HUSin alueella sairaalahoitoa, Heinonen huomauttaa.

Tauti tappaa joka vuosi 120 000 alle 5-vuotiasta

RS-virus tunnistettiin jo 1950-luvulla ja ensimmäiset tutkimukset rokotteen kehittämiseksi alkoivat 60-luvulla. Silloisessa rokotekehityksessä tapahtui kuitenkin vakava haittatapahtuma, joka keskeytti rokotteen kehittämisen vuosikymmeniksi.

– Tuolloin kaksi rokotetta saanutta lasta kuoli ja 80 prosenttia sitä saaneista joutui sairaalahoitoon. Selvityksissä on päädytty siihen, että kehitteillä ollut, kokonaisia formaliinilla inaktivoituja viruksia sisältävä rokote olikin virheellisesti voimistanut tautia suojaavien vasta-aineiden muodostamisen sijaan, Heinonen kertoo.

Viime vuosina rokotteen kehittämisessä on otettu taas edistysaskelia.

– Suomessa RS-virukseen kuolee vauvoja laadukkaan sairaalahoidon ansiosta harvoin, mutta maailmalla sen seurauksena menehtyy joka vuosi 120 000 alle 5–vuotiasta lasta.

RSV:n aiheuttamat alahengitystieinfektiot johtavat maailmanlaajuisesti vuosittain 3,2 miljoonaan sairaalahoitojaksoon alle 5-vuotiailla. Kuvituskuva.Bagus Indiahono / EPA

– Erityisesti matalan ja keskitulotason maissa se on yksi merkittävimmistä imeväisikäisten lasten kuolleisuutta aiheuttavista sairauksista. Kehitysmaissa RSV on heti malarian jälkeen seuraavaksi yleisin pienten vauvojen kuolinsyy, Heinonen korostaa.

Suomi on mukana rokotetutkimuksessa, jossa odottavan äidin rokottaminen saa elimistön tuottamaan vasta-aineita, joiden toivotaan siirtyvän istukan kautta sikiön verenkiertoon.

Rokotteen toivotaan näin suojaavan vastasyntynyttä RSV-infektiolta vauvan kriittisimmät ensimmäiset elinkuukaudet.

Suomessa tutkittavaa uutta rokotetta on Heinosen mukaan annettu aiemmin muualla ilman merkittäviä haittavaikutuksia jo yli 2 000 tutkimukseen osallistuvalle, mukaan lukien nelisen sataa raskaana olevaa naista.

Rokotteiden antaminen raskaana oleville naisille syntyvän lapsen suojaamiseksi ei ole uusi asia.

– Kausi-influenssarokotetta suositellaan kaikille raskaana oleville naisille Suomessa. Monissa muissa maissa myös hinkuyskärokotetta suositellaan odottaville äideille vastasyntyneen suojaamiseksi.

Nämä rokotteet on Heinosen mukaan todettu turvallisiksi ja syntyvää lasta suojaaviksi.

Rokotetutkimuksessa käynnissä useita eri haaroja

RS-viruksen torjumiseksi on maailmalla käynnissä erilaisia rokotetutkimushankkeita:

1. Odottavan äidin rokottaminen, joka saa elimistön tuottamaan vasta-aineita, joiden toivotaan siirtyvän istukan kautta sikiön verenkiertoon, jossa Suomikin on mukana.

2. Jo käytössä olevasta pienten tai sydänvikaisten keskosten tai sydänvikaisten vauvojen RS-virusta ennaltaehkäisevästä monoklonaalisesta vasta-aineesta on kehitetty pitkäkestoisempi, ensimmäiset elinkuukaudet suojaava pistos, joka ei vaadi immuunivasteen kehittymistä.

3. Pinta-antigeenirokote, joka on suunnattu vanhemmille lapsille, aikuisille ja vanhuksille.

4. Vektorirokeote jossa käytetään apuna toista virusta, jota on muokattu siten, että se ilmentää pinnallaan RS-viruksen proteiineja.

5. Elävä heikennetty rokote, jota on geneettisesti muokattu siten, että se aiheuttaisi immuunivasteen nenäsuihkeena, kuten esimerkiksi yli 2-vuotiaille lapsille annettava suihkemuotoinen influenssarokote tekee.

Suomessa tutkimukseen haetaan 250 vapaaehtoista odottavaa äitiä

Suomi on mukana rokotevalmistaja Pfizerin suunnittelemassa ja rahoittamassa maailmanlaajuisessa tutkimuksessa, johon osallistuu yhteensä noin 6 900 odottavaa äitiä ja heidän vauvaansa 17 eri maasta.

Suomessa rokotetutkimukseen osallistuminen kestää äidin osalta noin 10 kuukautta ja vauvan osalta kaksi vuotta. Kuvituskuva.Henrietta Hassinen / Yle

Suomen rokotetutkimus toteutetaan HUSiin kuuluvassa Meilahden rokotetutkimuskeskus MeVacissa ja Tampereen yliopiston Rokotetutkimuskeskuksen tutkimusklinikoilla eri puolella Suomea.

Meilahden rokotetutkimuskeskuksessa on parhaillaan käynnissä vapaaehtoisten raskaana olevien äitien rekrytointi, jonka tarkoituksena on löytää ja rokottaa 70 odottavaa äitiä kahden talven aikana. Kokonaisuudessaan Suomesta on tavoittena rekrytoida tutkimukseen 250 odottavaa äitiä. Osallistuminen kestää äidin osalta noin 10 kuukautta ja vauvan osalta noin kaksi vuotta.

Testattava roketevalmiste ei sisällä eläviä eikä tapettuja kokonaisia viruksia, eikä adjuvanttia eli tehosteainetta. Lumerokote, jota tutkimuksessa saa puolet rokotetuista, on suolaliuosta.

– Mielenkiintoista on nähdä on minkälaisena RSV-epidemia ilmenee tulevana talvena koronavarotoimien vuoksi, koska kevään influenssa ja RS-virus epidemia lähes katosivat koronan torjumisen myötä, Heinonen pohtii.

Lue myös:

Suomessa sairastetaan miljoonia flunssia vuodessa – ihmisen puolustusmekanismi taistelee viruksia vastaan, mutta omaa vastustuskykyään voi lähinnä vain heikentää

Kansainvälinen energiajärjestö: Ilmastotavoitteita ei enää voida saavuttaa ilman valtavaa panostusta hiilidioksidin talteenottoon suoraan tehtaista

Thu, 24/09/2020 - 16:45

Kansainvälinen energia-alan yhteisjärjestö IEA arvioi, ettei maailma voi enää saavuttaa ilmastopäästöjen vähentämistavoitteita, ellei hiilidioksidin talteenottoa ja varastointia kasvateta nopeasti.

IEA on julkaissut laajan raportin, jossa se kuvaa tarvetta hiilidioksidin talteenottoon ja varastointiin sekä mahdollisuuksia sen hyödyntämiseen teollisuudessa ja energiantuotannossa.

– Ilman sitä energia- ja ilmastotavoitteemme käyvät mahdottomiksi saavuttaa, totesi IEA:n johtaja Fatih Birol raportin yhteydessä julkaistussa tiedotteessa.

Monet maat, Suomi niiden joukossa, ovat asettaneet tavoitteekseen, että hiilidioksidin nettopäästöt painuisivat nollaan vuosisadan puoliväliin mennessä. Tavoite on Pariisin ilmastosopimuksen mukainen.

Lue myös: Presidentti Niinistön kunnianhimoinen viesti YK:n yleiskokouksessa: “Suomesta maailman ensimmäinen fossiilivapaa valtio”

Tavoitteen saavuttamiseksi on käynnistetty monenlaisia ilmastotoimia, mutta niiden teho ei ole ollut toivotulla tasolla. IEA arvioi, että päästötavoitteen saavuttaminen edellyttää hiilidioksidin talteenoton, hyötykäytön ja varastoinnin (Carbon capture, utilisation and storage, CCUS) 20-kertaistamista teollistuneissa maissa vuoteen 2030 mennessä.

IEA:n mukaan tällä hetkellä on toiminnassa noin 20 CCUS-laitosta, joiden kapasiteetti on yhteensä 40 miljoonaa tonnia hiilidioksidia vuodessa. Järjestön mukaan vuosikymmenen lopussa talteen pitäisi saada vuosittain 800 miljoonaa tonnia hiilidioksidia.

IEA:n johtaja Fatih Birol.Marcel Bieri / EPA Toimii jo nyt, mutta hinta hirvittää

Hiilidioksidia otetaan jo nyt talteen varsinkin maakaasun tuotannossa ja lannoiteteollisuudessa. Teknisesti talteenotto on mahdollista muuallakin, mutta esteenä on toiminnan korkea hinta.

IEA peräänkuuluttaa selkeitä poliittisia päätöksiä, joiden perusteella yritykset voisivat tehdä päätöksiä tutkimustoiminnan ja investointien suuntaamisesta. Järjestö vaatii myös varsinkin raskasta teollisuutta käynnistämään tarvittavat muutosprosessit, koska IEA:n mukaan ne ovat väistämättömiä.

IEA:n mukaan varsinkin öljy- ja kaasuyhtiöillä on teknologista osaamista sekä riittävät taloudelliset resurssit kustannustehokkaampien CCUS-laitteiden kehittämiseen ja käyttöönottoon.

Talteenottolaitteet olisi IEA:n mielestä tärkeää saada nopeasti suurimpiin päästölähteisiin, joita ovat esimerkiksi rauta-, teräs- ja sementtitehtaat.

Liiketoiminnalliset mahdollisuudet ovat suuret. IEA arvioi, että CCUS-toimintaan on investoitava tällä vuosikymmenellä maailmanlaajuisesti 160 miljardia dollaria.

Ensin imurit savupiippujen päihin, sitten suoraan ilmasta

Maailman energiajärjestön näkemys on, että hiilidioksidin talteenottolaitteistoja asennetaan aluksi olemassaoleviin teollisuuslaitoksiin.

Ensi vuosikymmenellä painopiste siirtyy hiilen talteenottoon bioenergialaitoksista. Myöhemmin hiilidioksidia poistettaisiin suoraan ilmasta. Näin ilmakehän hiilidioksidipitoisuutta voitaisiin vähentää muiden ilmastotoimien ohella.

IEA uskoo, että vetyenergialla on tulevaisuudessa suuri rooli etenkin liikenteen polttoaineena. Talteenotettu hiilidioksidi olisi kustannustehokas raaka-aine vedyn valmistukseen. Hiilidioksidilla on paljon muitakin käyttömuotoja.

Lue myös: VTT: Hiili ei olekaan pelkkää saastetta – hiilidioksidin uusiokäytöllä valmistetuilla tuotteilla ilmastonmuutoksen kannalta suotuisia vaikutuksia

Minne varastoida miljoonia tonneja hiiltä?

Talteenotettua hiilidioksidia voidaan varastoida esimerkiksi maaperään tai merenpohjaan. IEA:n raportissa todetaan, että teknistä kapasiteettia varastointiin maapallolla on runsaasti.

Varastoinnin hankaluus liittyy siihen, joudutaanko talteenotettua hiilidioksidia kuljettamaan pitkiä matkoja varastointipaikalle. IEA:n mukaan matka talteenottopaikasta varastointipaikalle ei pitäisi olla pitempi kuin sata kilometriä.

Yhdysvalloissa keskimääräinen hiilidioksidin kuljetusmatka on nykyään 180 kilometriä.

IEA esittää, että jatkossa CO2:n käsittelyyn muodostuisi keskuksia, joissa kuljetusmatkat olisivat mahdollisimman lyhyitä. Tämä vähentäisi infrastruktuurikuluja.

IEA julkisti raporttinsa tilaisuudessa, jonka avasi Norjan pääministeri Erna Solberg. Norja kertoi alkuviikosta suurista suunnitelmista hiilen talteenotto- ja varastointijärjestelmien rakentamiseksi. IEA:n johtaja Birol kehui Norjan nousseen Euroopan johtavaksi maaksi CCUS-teknologian edistämisessä.

Lue myös: Norjan hallitus kertoi jätti-investoinnista hiilidioksidin talteenottoon ja varastointiin – mukana myös suomalainen Fortum

Lue lisää hiilidioksidin talteenotosta ja varastoinnista täältä.

Koronarokotetta kehitään sekä vanhoilla ja koetelluilla keinoilla että uusilla, jotka lupaavat paljon mutta näyttö vielä puuttuu

Thu, 24/09/2020 - 12:29

Tässä kisassa voittajaa voisi pitää ilmiselvänä. Yhdessä kulmassa on ennätysmäärä lääketieteellistä panostusta, toisessa pienenpieni virus, joka ei yritäkään tutkijoilta karkuun perimänsä muutoksilla, vaan on biologisesti sama kuin silloin, kun se alkoi levitä pandemiana.

SARS-CoV-2:n koko genomi selvitettiin Kiinassa tammikuussa ja jaettiin kaikkien tutkijoiden käyttöön.

Samassa kuussa oli selvillä myös tärkeä tieto viruksen pinnalla sojottavien piikkien proteiinin rakenteesta. Piikkiproteiininsa avulla virus tarttuu keuhkosoluun ja pääsee sen sisälle. Vain sillä tavoin virus voi lisääntyä.

Vaikka vastustaja on näennäisesti höyhensarjaa ja sen salaisuudet päällisin puolin selviä, kukaan ei voi vieläkään sanoa, kuinka tehokkaasti COVID-19 on nujerrettavissa rokotteella ja kuinka kauan siihen menee aikaa.

Ihmiskokeisiin on nyt edennyt 40 COVID-19 rokotetta, ja yli 90 on eläinkoevaiheessa. Valtaosa yrityksistä päättyy väistämättä pettymykseen, sillä rokotteiden kehittäminen on paitsi hidasta ja kallista, niin kaikissa vaiheissaan hyvin epävarmaa.

COVID-19-rokotehankkeissa avainasemassa on piikkiproteiini, mutta yhdentekeviä eivät ole myöskään nukleokapsidin, kalvon ja vaipan proteiinit, saati RNA, viruksen rakennuspiirustus. Tältä SARS-CoV-2-virus näyttää:

Tyrmäysvoittoa SARS-CoV-2-viruksesta ei ole odotettavissa, ei niin kuin isorokosta, maailman ainoasta rokotteella hävitetystä tartuntataudista. Se oli loistava voitto, mutta siihen meni kaksi vuosisataa rokotteen ensi version keksimisestä.

Tehokkaan rokotteen nopeusennätys on sikotautirokotteella, neljä vuotta. Nyt ennätys yritetään kuroa puoleentoista vuoteen, ellei allekin, ja voitoksi ollaan kelpuuttamassa paljon vähemmän kuin viruksen täystyrmäys.

Rokotetta ollaan valmiita pitämään tehokkaana, jos se vähentää tartunnan todennäköisyyden puoleen. Voitoksi lasketaan myös se, jos rokote antaa suojaa ainakin vuodeksi kerrallaan.

Laboratoriossa lupaava tarvitsee monta testiä

Rokotteiden tehtävä ei ole tappaa virusta, vaan saada elimistön puolustusvoimat valppaiksi. Immuunijärjestelmä luulee rokotetta oikeaksi taudinaiheuttajaksi ja painaa sen mieleensä vastaisen varalle.

Rokotteiden aseet ovat monenlaisia, vanhoista ja koetelluista uudenlaisiin, joiden valttina on vauhti mutta epävarmuutena se, ettei niitä ole käytetty tosi toimissa tartuntoja vastaan.

Olivatpa rokotteiden keinot mitä tahansa, laajat ja onnistuneet kenttäkokeet ovat tarpeen ennen kuin rokote voidaan julistaa valmiiksi.

Kun laboratoriossa ja eläinkokeissa on päädytty lupaaviin antigeeneihin eli vaikuttaviin aineisiin ja kenties tarvittaviin tehoste- ja muihin apuaineisiin, tulos on testattava ihmisillä kolmessa vaiheessa eli faasissa – ensin varoen pienellä porukalla ja lopulta mahdollisimman monella kymmenellätuhannella.

Sadoissa laboratoriossa ympäri maailmaa on otettu käyttöön niin vanhat kuin uudet keinot, jotta markkinoille saataisiin kolme ehtoa täyttävä rokote: turvallinen, elimistön immuunivasteen herättävä ja tehokas nujertamaan juuri COVID-19.

Kananmunassa kasvatettu virus

Yli sadan vuoden ikäisessä rokotteiden valmistustavassa virus käännetään sotimaan itseään vastaan riisumalla tai heikentämällä sen tartuttamiskyky.

Nämä rokotteet ovat tehokkaita, mutta niiden valmistaminen on hidasta. Viruksia tarvitaan valtavasti, ja niiden kasvattaminen kananmunissa tai soluviljelmissä, puhdistaminen ja heikentäminen vievät aikaa.

Viruksia heikentämällä on tehty muun muassa kolmoisrokote tuhka- ja vihurirokkoa sekä sikotautia vastaan.

Toimintakyvyttömyyteen eli inaktivointiin perustuvat puolestaan muun muassa polio- ja hepatiitti A -rokotteet, ja tällä keinolla rokotetaan myös kausi-influenssoja vastaan.

Syyskuun tilannekatsaus kertoo, että kiinalaiset lääkeyritykset Sinovac ja Sinopharm ovat edenneet kolmosfaasiin kolmella COVID-19:ää vastaan kehitetyllä rokotteella, joiden pohjana on inaktivoitu SARS-CoV-2-virus.

Apuri toisesta viruksesta

Vektorirokotteissa ihmisen elimistöön ei tuikata virusta, jota vastaan rokote on tarkoitettu, vaan kuljettajaviruksia, jotka saavat viemisikseen rokotteen kohdeviruksen geenejä. Niiden tarkoitus on saada elimistö varuilleen todellisen hyökkääjän varalta.

Vektorivirus on käsitelty niin, ettei se kykene aiheuttamaan omaa tautiaan. Toisinaan vektorilta viedään myös kyky monistua isäntäsolussa.

Useimmiten, myös COVID-19-rokotteissa, vektori on adenovirus. Se aiheuttaisi lievän hengistystieinfektion, ellei sitä olisi manipuloitu.

Vektorimenetelmä on jo pitkään ollut hyväksytyssä käytössä geeniterapiassa, mutta ei koskaan rokotteissa.

Koska kyse on geenimanipulaatiosta, menetelmä on herättänyt myös epäilyksiä mahdollisista pysyvistä ja periytyvistä vaikutuksista kohdesolun genomiin.

COVID-19:ää vastaan kehitetyistä vektorirokotteista kolmosfaasissa ovat Oxfordin yliopiston ja AstraZeneca-yhtiön, kiinalaisen CanSino Biolocsin sekä venäläisen Gamalejan tutkimuslaitoksen rokotteet.

Ei virusta, rakennuspiirustus riittää

DNA- ja RNA-rokotteissa ei tarvita viruksia, vaan rokotteet perustuvat niiden geneettiseen käsikirjoitukseen, josta ihminen tekee kopion.

Solu lukee käsikirjoituksen ja alkaa tuottaa sen mukaista proteiinia, jota immuunijärjestelmä luulee vihollisen proteiiniksi ja havahtuu aseisiin.

Tällaiset rokotteet ovat nopeita valmistaa, mutta niiden toimivuutta ei ole koskaan koeteltu. COVID-19-rokotteissa ne ovat ensi kertaa todellisissa tulikokeissa.

SARS-CoV-2-viruksen geneettinen aines on RNA:ta. Siinä missä DNA-viruksen täytyy päästä isäntäsolun tumaan valmistaakseen itselleen lähetti-RNA:ta, useimpien RNA-virusten proteiinisynteesi hoituu suoraan solulimassa.

RNA-rokotteen kolmosfaasi on käynnissä yhdysvaltalaisella Moderna-lääkeyhtiöllä sekä saksalaisen BioNTechin, yhdysvaltalaisen Pfizerin ja kiinalaisen Fosum Pharman yhteisellä hankkeella.

Nelosfaasiin osallistuu koko maailma

Normaalisti tutkimusten kolmosfaasi kestää vuosia, jotta ehditään nähdä, kuinka pitkän immuniteetin rokote antaa ja aiheutuuko siitä kenties sivuvaikutuksia, jotka ilmenevät vasta ajan kuluessa.

COVID-19-pandemia on saanut nopeuttamaan ja yhdistelemään faaseja, ja viranomaisetkin ovat antaneet vihreää valoa pikakaistalle. Heistä lopulta riippuu, mitkä rokotteet ovat arvioitavissa niin tehokkaiksi ja turvallisiksi, että niille voidaan antaa myyntilupa.

Kiinan asevoimissa on jo käytössä yksi kolmosfaasin rokotteista, ja Arabiemiraatit antoi vastikään luvan rokottaa terveydenhuollon työntekijöitä toisella kolmosfaasin kiinalaisrokotteella. Venäjä sen sijaan pyörsi protestien vuoksi päätöksen aloittaa rokotukset Gamalejan tutkimuslaitoksen rokotteella jo ennen kolmosfaasia.

Täysin testatuksi rokotteiden turvallisuus tulee vasta, kun kaikki halukkaat seisovat rokotusjonoissa. Niitä onkin tapana nimittää nelosfaasiksi.

Kaikkein harvinaisimmat haittavaikutukset eivät tule esille ennen kuin rokotetaan miljoonia ihmisiä – tai COVID-19:n tapauksessa ehkä pikapikaa miljardeja.

Lue myös:

Täältä voit lukea kaikki tuoreimmat uutiset koronaviruksesta.

Tilastokeskus: Työttömiä neljännes enemmän kuin vuosi sitten – työllisyysaste painunut selvästi alle 72 prosentin

Tue, 22/09/2020 - 08:09

Tilastokeskuksen työvoimatutkimuksen mukaan elokuussa työllisiä oli 65 000 vähemmän kuin vuotta aiemmin. Kausitasoittamaton työllisyysaste laski kahdella prosenttiyksiköllä 71,5 prosenttiin vuoden takaisesta.

Työllisyysasteen trendiluku, josta on poistettu kausi- ja satunnaisvaihtelu, oli 71,6 prosenttia. Vuotta aiemmin lukema oli 72,7 prosenttia. Trendiluku kääntyi laskuun tammikuun jälkeen 73 prosentista. Työllisiä oli elokuussa runsaat 2,5 miljoonaa.Työttömien määrä puolestaan lisääntyi neljänneksellä verrattuna vuoden takaiseen. Tämän vuoden elokuussa työttömiä oli 211 000, mikä oli 42 000 enemmän kuin vuotta aiemmin.

Kausitasoittamaton työttömyysaste oli elokuussa 7,7 prosenttia, kun vuotta aiemmin se oli 6,1 prosenttia. Työttömyysasteen trendiluku oli 7,5 prosenttia.

Työttömiä suhteessa eniten Pohjois-Karjalassa

Työ- ja elinkeinoministeriön työnvälitystilaston tietojen mukaan TE-toimistoissa oli elokuussa 330 000 työtöntä työnhakijaa, mikä on 40 prosenttia enemmän kuin vuotta aiemmin. Kokoaikaisesti lomautettuina oli 61 000, mikä on 54 000 enemmän kuin vuosi sitten.

Korkeimmillaan työttömien työnhakijoiden osuus työvoimasta oli Pohjois-Karjalan ely-keskuksen alueella 15,2 prosentin lukemalla. Sen jälkeen korkeinta työttömyys oli Keski-Suomessa, Lapissa, Kaakkois-Suomessa ja Uudellamaalla, joissa kaikissa se ylitti hieman 13 prosenttia.

Suhteellisesti TE-toimistoissa kirjoilla olleiden työttömien työnhakijoiden määrä kasvoi vuoden takaisesta eniten Ahvenmaan ely-keskuksen alueella, jossa luku yli kolminkertaistui. Toiseksi eniten nousua oli Uudellamaalla, jossa oli 60 prosenttia enemmän työttömiä työnhakijoita kuin vuosi sitten. Pienintä suhteellinen muutos oli Kainuussa.

Tanskan kuninkaan lippulaivan hylystä löytynyt jättiläiskala on 1400-luvun propaganda-ase ja viesti Itämeren kadotetusta luonnontilasta

Sun, 20/09/2020 - 19:17

Tanskan ja Norjan kuningas Hannu oli vuoden 1495 juhannuksen paikkeilla lähdössä Ruotsiin muistuttamaan, että oikeastaan Ruotsin – ja samalla Suomen – kruunu kuului hänelle. Asemaansa korostaakseen hän lastautti lippulaivaansa hovinsa komeinta omaisuutta.

Ruotsin ovelaa valtionhoitajaa Sten Sturea ja muita nokkamiehiä oli määrä pehmitellä myös muhkealla aterialla. Sitä varten mukaan pilkottiin kaksimetrinen sinisampi. Palaset pantiin puutynnyriin, tutkijoiden mukaan oletettavasti suolaveteen. Fileointi ei ehkä ollut ajan tapa.

Ateria jäi kokkaamatta, sillä Ronnebyn saaristoon ankkuroituneella aluksella syttyi tulipalo. 35 metriä pitkä ja 12 metriä leveä kolmimastoinen Gribshunden kaikkine komeuksineen painui merenpohjaan.

Ei ehditty pelastaa kultaa eikä hopeaa, suri aikalaiskronikka. Valtaosa 150-henkisen miehistön jäsenistä kuoli, mutta Hannu säästyi, sillä hänet oli soudettu yöksi maihin.

Kun ruotsalainen sukellusseura löysi hajonneen ja suurelta osin sedimenttiin peittyneen aluksen 1970-luvulla, löydön merkitystä ei ymmärretty.

Hylky alkoi kuitenkin kiinnostaa yhä useampaa tutkijaa, ja vuonna 2013 alus lopulta varmistui Gribshundeniksi.

Hylystä on sittemmin nostettu muun muassa ankkurivinssi sekä tykinkuulia ja varsijousien nuolia eikä suinkaan vähäisimpänä aluksen keulakuva, aarnikotka tai pikemminkin -koira, jolla on suussaan ihmisen pää.

Hylky on ainutlaatuinen aikaikkuna myöhäiskeskiaikaan, tuolloin juuri muotiin tulleeseen laivanrakennustapaan sekä laivastoon, joka Itämerelle oli alkamassa syntyä.

Viime syksyn kansainvälisissä kaivauksissa löytyi poikkeuksellisen varhainen käsiase. Löytöjen joukossa on myös arvokkaan rengashaarniskan kappaleita, kenties vihje Hannun "fatabuurista".

Se oli kaappi, jossa säilytettiin kuninkaan arvokkaimpia esineitä ja vaatteita. Keskiaikaisten lähteiden mukaan sekin oli mukana matkalla, ja saattaa se löytyäkin, sillä Gribshundenin hylystä on tutkimatta 99 prosenttia.

Myös sammen luut ja luulevyt, joiden analyyseistä Lundin yliopiston tuore tutkimus kertoo, löytyivät vuoden takaisissa meriarkeologisissa kaivauksissa. Tutkimus on vapaasti luettavissa Journal of Archaeological Science -lehdestä.

Aikalaislähteet kutsuvat Gribshundenia myös Gripshundeniksi, Gripeniksi ja Griffiniksi.

Itämeren vähähappisen ja -suolaisen veden ansiosta Gribshundenin hylky on säilynyt paljon paremmin kuin aikakautensa hylyt muissa merissä.

Veden viileyskin on ollut omiaan pitämään laivamadot – puuta jyrsivät nilviäiset – loitolla Gribshundenista ja muista Itämeren hylyistä, joiden määrä arvioidaan jopa yli sadaksituhanneksi.

Tilanne on kuitenkin muuttumassa. Viime vuosikymmeninä laivamatoja on havaittu aiempaa enemmän, myös alueella, jossa Gribshunden makaa. Tutkimusten mukaan laivamadot ovat lisääntyneet rinnan meriveden lämpenemisen kanssa.

Näin paljon Hannu-kuninkaan sammesta on säästynyt puolen vuosituhannen takaa. Brendan Foley / Lundin yliopisto

Luututkijalle kalanpalat olivat huippulöytö, etenkin kuninkaallisessa kontekstissa, joka vahvistaa konkreettisesti, että sampi oli arvossaan jo keskiajalla, sanoo Lundin yliopiston osteoarkeologi Stella Macheridis.

–Kaikki kuninkaan aluksessa täytti poliittista tehtävää. Sampikin oli propagandan väline ja siksi mielenkiintoinen, lisää meriarkeologi Brendan Foley.

Hylky esineineen, myös sampineen, antaa olennaista tietoa ajankohdasta, jolloin Euroopa oli mullistumassa poliittisesti, uskonnollisesti ja taloudellisesti, Foley sanoo.

Itämeressä ei ole enää lajitovereita

Kala oli suuri. Sen osoittaa kylkiä peittäneiden luulevyjen koko. Lajista sen sijaan oli epäselvyyttä. Pitkään luultiin, että jättiläinen oli lajia, jota suomeksi kutsutaan vain sammeksi. Sinisammeksi löytö osoittautui DNA-analyyseillä.

Gribshundenin aikaan Itämeressä polski niin sampia kuin sinisampia. Nykyisin niitä ei ole. Ennen muuta ylikalastus mutta myös elinypäristöjen tuhoutuminen ja rantavesien saastuminen on tehnyt niistä selvää.

Jos joku nykyisin saa Suomen vesiltä sammen, se on jokseenkin varmasti peräisin Virossa tai Venäjällä tehdyistä istutuksista. Vain hyvin satunnaisesti Itämereen saattaa enää eksyä yksittäinen villi sampi.

Muuallakin kaikki sampikalat kuuluvat maailman kaikkein uhanalaisimpiin kalalajeihin.

Hannun sinisammesta olivat säästyneet näillä kohdin olleet luulevyt. Stella Macheridis & Brendan Foley / Lundin yliopisto

Itämeren tilan tutkimukseen erikoistunut molekyylibiologi Maria Hansson korostaa Gribshundenin sampilöydön merkitystä hänen omalle alalleen.

– Löytö auttaa ymmärtämään, miltä Itämeressä näytti ennen kuin pilasimme sen. Sellaista tietoa tarvitaan meren nykytilan ymmärtämisessä, sanoo DNA-tutkimukset tehnyt Hansson.

Tuloksista hän päättelee, että nykyisin Pohjois-Amerikan vesissä elävä sinisampi oli 1400-luvulla osa myös Itämeren ekosysteemiä.

Aiemmin oletettiin, että Itämeren sammet olivat olleet eurooppalaista lajia. Vasta tämän vuosituhannen alussa valkeni, että ainakin viimeiset täkäläiset luonnonsammet olivatkin sinisampia.

Suojeluhanke yrittää pelastaa Tonavan sammet

Tammikuussa Yle uutisoi miekkasammen katoamisesta iäksi maailman kalalajien joukosta. Jangtsejoessa Kiinassa eläneen lajin tappoivat sukupuuttoon juuri ne syyt, joiden takia sammet muissakin joissa ovat hyvin ahtaalla: ylikalastus ja padot.

Tonavan alajuoksu ja Mustanmeren luoteisosa ovat EU:n harvoja alueita, joissa sampipopulaatiot yhä lisääntyvät viljelemättä.

Tonavan kuudesta luonnon sampilajista viisi on vakavasti uhanalaisia. Suurimpana vaarana on salakalastus, johon houkuttelee sampien mäti eli kaviaari. Siitä voi saada jopa kymmenentuhatta euroa kilolta.

Luontojärjestöjen nelivuotinen valistushanke sampien suojelemiseksi Tonavan rantavaltioissa päättyy joulukuussa. Sampien ahdingosta on annettu tietoa kalastajille, lainlaatijoille ja -valvojille sekä kaviaaria tarjoileville ravintoloille ja myyville kaupoille.

Kampanja on voinut laskea voitokseen muun muassa sen, että Serbiassa tuli viime vuonna voimaan sterlettien pyyntikielto. Sterletit olivat viimeinen sampilaji, joka vielä oli lainsuojaton Tonavan alajuoksulla.

Sampilajeista pienimpiin kuuluvia sterlettejä elää Euroopan itä- ja Siperian länsipuolikkaan joissa. Sterleteille kelpaa murtovesikin, mutta merivesi ei. Andreas Hartl / Würzburgin yliopisto

Sterletti ja muut sampilajit ovat fossiililöytöjen perusteella säilyneet saman näköisinä jopa 250 miljoonaa vuotta. Luonnontutkija Charles Darwin nimitti niitä eläviksi fossiileiksi. Niitä vanhempia lajeja maapallolla ei enää juuri ole.

Sellaisina niiden perimä on evoluution tutkijoille hyvin mielenkiintoinen. Viime keväänä ilmestyneessä kansainvälisessä tutkimuksessa avattiin sterletin koko perimä.

– Sampien genomi on tärkeä osanen palapelissä, joka auttaa ymmärtämään selkärankaisten kehittymistä. Tähän saakka palanen on puuttunut, kertoi tutkimusta johtanut saksalaisen Wüzburgin yliopiston biokemian professori Manfred Schartl.

Dinosaurusten aikalaisia

DNA:ta sampien synnyinajoilta ei toki ole, vaan genomin sekvensoiti perustui nykysterlettien geenien koodaamiin proteiineihin ja niistä taaksepäin tehtyihin laskelmiin

Kehitys osoittautui hyvin hitaaksi, samoin kuin hailla ja varsieväkaloilla, merien muilla varhaisten dinosaurusten aikalaisilla.

Viimeisten sterlettiä olennaisesti muuttaneiden mutaatioiden todettiin tapahtuneen 180 miljoonaa vuotta sitten. Vertailun vuoksi: me nykyihmiset olemme lajina tällä tietoa korkeintaan hieman yli 300 000 vuoden ikäisiä.

Samasta sukupuusta kuin sammet on versonut yli 30 000 luukalalajia eli yli 96 prosenttia kaikista tämän päivän kalalajeista ja noin puolet selkärankaisista ylipäätään.

Sampilajien geenien sekvesointi on merkittävä askel myös suojelutyössä, tutkijat korostavat. Sampien sukupuoli ei näy ulospäin, mikä hankaloittaa yrityksiä saada ne lisääntymään suojeluohjelmissa. Kun perimä tunnetaan, sukupuolikin on selvitettävissä DNA-näytteestä.

Voit keskustella tästä aiheesta maanantaihin kello 23:een saakka.

Lue myös:

Mertensuojelun supervuosi kuivahti koronaviruksen takia – merten armonajaksi lasketaan kymmenen vuotta

Jani Kaaron kolumni: Pieni torjuntavoitto torjunta-aineista

Sun, 20/09/2020 - 06:45
Kolumni

Kolumneja kirjoittaa laaja joukko Ylen ulkopuolisia tekijöitä.

> Kaikki kolumnit löydät täältä
> Ykkösaamussa kuullut kolumnit Areenassa ja podcasteina

Ostin supermarketista omenoita. Ne olivat italialaisia, merkkiä Evelina. Halusin tietää enemmän italialaisista omenoista, joten menin nettiin. Siellä törmäsin tähän tarinaan. Nyt pitää kertoa se teille.

En tiedä mistä evelinani tulivat, mutta on paljon mahdollista, että ne olivat Etelä-Tirolista. Etelä-Tirolista on viimeisen kolmenkymmenen vuoden aikana kehkeytynyt Euroopan suurin omenantuotantoalue. Sen reilut 18 000 omenantuotannolle omistettua hehtaaria tuottaa markkinoille vuosittain noin miljoona kiloa omenia. Noin joka seitsemäs omena, jonka poimit eurooppalaisesta supermarketista, on peräisin Etelä-Tirolista.

Syy siihen, miksi Etelä-Tiroli on muuttunut yhdeksi suureksi omenatarhaksi, on suotuisa ilmasto ja viljelyn kannattavuus. Suurin osa alueen niistä viljelijöistä, jotka eivät ole vielä vaihtaneet omenaan, sinnittelevät jotenkin, mutta omenasta voi saada 25 000-40 000 euroa per hehtaari.

Jos ylläkuvattu saa sinut kuvittelemaan romanttisen näkymän, jossa vanhat käkkyräiset omenapuut levittäytyvät alppirinteille ja niiden juurilla on punaisia omenia kuin pallomeressä, tämä ei aivan vastaa todellisuutta. Omenapuut täällä ovat kääpiökasvuisia ja ne kasvavat suorissa riveissä puu- tai metallikehikoissa hieman kuin jokin köynnöskasvi. Suurin osa alueen omenatarhoista on pieniä, mutta kun niitä on vieri vieressä, tuloksena on valtava monokulttuuri: omenarivejä silmänkantamattomiin.

Tällainen valtava omenakeskittymä kerää luonnollisesti omenan tuholaisia, joita koetetaan kontrolloida erilaisilla torjunta-aineilla. Ja näin pääsemmekin siihen varsinaiseen tarinaan.

Koska omenantuotanto Etelä-Tirolissa on niin kannattavaa, uusille omenatarhoille raivataan jatkuvasti uutta tilaa. Kiitos lämpenevän ilmaston, omenatarhat ovat alkaneet hivuttautua yhä korkeammalle Alppien rinteille. Ja näin ylös hivuttautuessaan ne lähestyivät pientä Malsin pikkukaupunkia.

Mals on juuri sellainen Alppien pittoreski pikkupaikka, jossa kaikki tehdään vähän vanhanaikaisesti. Viljelmät ovat pieniä ja luomua, ei siksi, että luomu on muotia, vaan koska niin ollaan aina tehty. Paikallinen maidontuottaja tuottaa luomumaitoa. Luomumaidosta paikallinen juustoyrittäjä valmistaa luomujuustoa. Viljelijät kasvattavat luomuviljaa, josta paikalliset leipomot valmistavat luomuleipää. Kaikki on paikallista, luonnonmukaista ja vanhanaikaista.

Mutta sitten kylän liepeille alkoi tulla omenatarhoja. Omenatarhojen rutiineihin kuuluu, että noin 20-30 kertaa kasvukauden aikana omenarivit ruiskutetaan erilaisilla torjunta-aineilla. Kukin viljelijä saa tietenkin tehdä omalla tilallaan mitä huvittaa, mutta entäpä jos torjunta-aineet kulkeutuvat naapuritiloille, ja nuo naapuritilat sattuvat olemaan luomutiloja?

Ensimmäisenä tämän ongelman kanssa joutui tekemisiin maitokarjan kasvattaja, jonka heinäniittyjen naapuriin omenatarha tuli. Hän havaitsi, että kun omenatarhalla ruiskutettiin, sieltä pöllähti pilvi hänen niityilleen. Hän otti näytteet eri puolilta niittyjä ja lähetti ne laboratorioon analysoitavaksi. Tulokset olivat tyrmistyttävät: kaikista näytteistä löytyi useita erilaisia torjunta-aineita. Koko heinäsato oli menetetty. Sama tapahtui seuraavana kesänä. Jos tilanne ei korjaantuisi, hän menettäisi luomusertifikaattinsa, ja koko hänen elantonsa perustui sille.

Seuraavaksi oli ongelmissa luomuyrttien tuottaja, joka niin ikään sai naapurikseen omenatarhan. Kun torjunta-ainepilvi pölähti hänen yrttipenkeilleen, asiaa koetettiin ratkoa yhdessä omenaviljelijän kanssa. Koetettiin turvavälejä, pensasaitaa ja jopa niin sanottua vesiseinää, mutta torjunta-aineet löysivät aina tiensä naapurin kasvatuksille. Ainoa ratkaisu oli siirtää yrtit kasvihuoneisiin.

Malsin viljelijät eivät olleet ongelmiensa kanssa yksin. Yhdysvalloissa Monsanton rikkaruohomyrkky, dikamba, on aiheuttanut konkreettisia satotappioita. Soijalle ja puuvillalle räätälöity rikkaruohomyrkky on kulkeutunut naapureiden pelloille ja tappanut hehtaareittain naapureiden viljelyksiä. Jos dikambaa on päässyt luomuviljelyksille, viljelijä on menettänyt tilapäisesti luomusertifikaattinsa. Viljelijät ovat nostaneet dikambaan liittyen oikeusjuttuja Monsantoa vastaan ainakin 25 osavaltiossa.

Malsin asukkaat eivät ole mitään poliittisia aktivisteja. He ovat tavallisia italialaisia, jotka elävät tavallista elämää. Mutta nyt he alkoivat vähitellen huolestua. Omenatarhoja oli tulossa ympäristöön yhä enemmän. Niiden mukana tulivat torjunta-aineiden pilvet.

Eikä asia koskenut vain viljelijöitä. Jos torjunta-aineet pölähtivät omenatarhoilta ympäristöön, kuinka kauas ne oikein menivät? Entäpä ihmiset? Entä lapset?

Alempaa laaksosta kantautui toisenlaisia uutisia. Turistit, vapaa-ajan matkailijat ja polkupyöräilijät valittivat torjunta-aineiden katkusta. Turistit, jotka odottivat näkevänsä alppimaisemia, eivät myöskään olleet innoissaan maiseman muuttumisesta: tasoitetuista rinteistä ja monotonisista viljelyriveistä. Kyläläiset alkoivat järjestäytyä. He ottivat yhteyttä kansalaisjärjestöihin ja yliopistoihin, joiden kautta järjestyivät ensimmäiset tutkimukset torjunta-ainetilanteesta.

Ensimmäisessä tutkimuksessa selvitettiin, päätyykö torjunta-aineita lasten leikkipuistoihin, jotka ovat kauempana omenatarhoista kuin naapurin pelto. Näytteitä otettiin 71 kohteesta Etelä-Tirolista, ja torjunta-ainejäämiä löytyi 32:sta. Erilaisia torjunta-aineita tunnistettiin kaikkiaan kaksitoista, näistä yleisimmät hyönteisten torjunnassa käytetty fosmeetti ja sieniä torjuva fluatsinami.

Toisessa tutkimuksessa, jossa näytteitä otettiin eri puolilta laaksoa – mukaan lukien pari luomutilaa – tunnistettiin ällistyttävät 20 erilaista torjunta-ainetta. Useimmissa mittauspisteissä ne esiintyivät noin 14 aktiivisen aineen cocktaileina.

Torjunta-aineiden käytöstä järjestettäisiin kansanäänestys.

Nyt kyläläiset alkoivat kysellä toisenlaisia kysymyksiä. Onko tähän vain pakko alistua? Eikö mitään ole tehtävissä? Eihän kukaan halunnut tällaista?

Niinpä muutaman kuukauden selvittelyjen jälkeen kyläläiset lähestyivät pormestaria ja saivat tämän puolelleen: torjunta-aineiden käytöstä järjestettäisiin kansanäänestys. Kansanäänestys järjestettiin elo-syyskuussa 2014 ja tulokset olivat selvät: yli 70 prosenttia kyläläisistä äänesti torjunta-aineiden käyttöä vastaan. Näin Malsista tuli ensimmäinen paikkakunta maailmassa, joka oli kieltänyt torjunta-aineiden käytön rajojensa sisällä.

Tarinan jatko ei kuitenkaan ole erityisen ruusuinen. Kaupunginvaltuustolta kesti kaksi vuotta laatia kansanäänestyksen tulokset asetuksiksi kuten mitkä torjunta-aineet olivat kiellettyjä ja mikä oli puskurivyöhykkeiden laajuus. Kun nämä saatiin valmiiksi, alkoi sarja oikeudenkäyntejä.

Omenanviljelijät haastoivat oikeuteen Malsin kaupungin sekä Malsissa asuvia yksityishenkilöitä, jotka olivat ajaneet kansanäänestystä. Osa näistä on päättynyt vasta äskettäin, kaikki malsilaisten eduksi, mutta osa on vielä kesken. Edessä voi olla pitkä oikeudenkäyntien tie, joka voi viedä Brysseliin asti.

Vuonna 2017 YK:n erikoisraportoija HIlal Elver jätti ihmisoikeusneuvostolle raporttinsa torjunta-aineiden käytöstä. Elverin mukaan väite siitä, että maapallon ruokaturva on riippuvaista torjunta-aineista, on myytti. Raportin mukaan torjunta-aineilla on katastrofaalisia seurauksia niin ympäristölle kuin ihmisten terveydelle. Raportti on hyvin kriittinen monikansallisia yhtiöitä kohtaan, syyttäen näitä aggressiivisesta markkinoinnista, hallitusten lobbaamisesta ja haittojen systemaattisesta kieltämisestä.

Yksi syy Malsin vastarintaan oli siinä, että kyläläiset huomasivat laululintujen kadonneen. Myös Ranskassa ja Englannissa peltolintujen kannat ovat romahtaneet, ja syyttävä sormi osoittaa torjunta-aineita, vaikkakaan ne eivät välttämättä ole ainoa syy.

Mals on ensimmäinen paikkakunta, joka on lähtenyt vastustamaan tätä kehitystä, ja se on vaikuttava siksi, että se tapahtuu demokratian keinoin. He kysyivät mitä ihmiset haluavat? Millaisessa ympäristössä he haluavat elää?

Ihmiset vastasivat ja aika näyttää seurataanko heidän esimerkkiään.

Tiedot Malsin tilanteesta ovat peräisin teoksesta: Philip Ackerman-Leist, A Precautionary Tale, Chelsea Green Publishing, 2017.

Jani Kaaro

Kirjoittaja on tietokirjailija ja vapaa toimittaja. Hän rakastaa filosofiaa ja inspiroituu vanhan ja uuden, tutun ja tuntemattoman sekoittumisesta, joka johtaa johonkin hedelmälliseen asiaan.

Kolumnista voi keskustella 21.9. klo 23.00 asti.

Hankalasti tutkittavista mikrolevistä paljastui sattumalta mielenkiintoista tietoa – tutkija epäili ensin näytteiden pilaantuneen

Fri, 18/09/2020 - 19:57

Uusi havainto mikrolevistä syntyi sattumalta. Tohtorikoulutettava Lumi Haraguchi teki tuolloin väitöskirjaansa Århusin yliopistossa Tanskassa. Hän oli eristänyt tiettyä nielulevälajia laboratorioviljelmiinsä.

Palattuaan lomaltaan helmikuussa 2017 Haraguchi tarkasteli leväkasvatuksiaan, jotka olivat unohtuneet joksikin ajaksi ilman valvontaa.

Kasvatettavat leväsolut olivat edelleen elossa, mutta Lumin hämmästykseksi ne olivat nyt eri lajia. Ensimmäinen ajatus oli, että leväkasvatukseen oli livahtanut mukaan vääriä lajeja.

Sama ilmiö toistui kuitenkin myös kontrolloiduissa olosuhteissa. Se sai Lumin arvelemaan, että nuo kaksi eri levälajia olivatkin saman lajin eri elämänvaiheita.

– Keskustelin asiasta Kööpenhaminan yliopiston tutkijoiden kanssa. He pitivät löydöstä mielenkiintoisena ja aloimme käydä läpi tutkimuksestani kertynyttä tietoa, tutkimme levien DNA:ta ja elekromikroskooppikuvia. Näin uusi tulos vahvistui, tutkija Lumi Haraguchi kertoo.

Hypoteesi vahvistettiin myöhemmin luonnossa sekä analysoimalla näiden kahden tavallisen nielulevälajin, Teleaulax amphioxeia ja Plagioselmis prolonga perimää. Niistä toisella on korkeampien organismien munista ja siittiöistä tuttu yksinkertainen eli haploidi kromosomisto, toisella puolestaan kaksinkertainen eli diploidi kromosomisto, kuten eläimissä ja kasveissa.

Uusi löydös osoittaa jälleen, miten rajallinen on tietämyksemme merissä elävistä eliöistä ja merien ekosysteemien toiminnasta.

Yksisoluisia leviä elektromikroskooppikuvissa. Lumi Haraguchi/Øjvind Moestrup/Lydia Garcia-Cuetos Sukupuolinen lisääntyminen solunjakautumisen sijasta

Pienien yksisoluisten levien on perinteisesti uskottu lisääntyvän kahtia jakautumalla ja tuottavan siten klooneja, mikä rajoittaa niiden geneettistä monimuotoisuutta ja sopeutumiskykyä muuttuviin ympäristöolosuhteisiin.

Nyt Lumi Harguchi ja tanskalaiskollegat havaitsivat ensimmäistä kertaa, että mikroskooppisten yksisoluisten levien lisääntymisstrategia muuttuu jakautumisesta seksuaaliseen lisääntymiseen silloin, kun niiden kasvu on rajoittunut resurssien puutteen takia.

Tutkimuksessa näin kävi typen puutteen vuoksi esimerkiksi kesäisin, kun vapaa typpi on lopussa ja valon määrä, lämpötila ja niihin kohdistuva saalistus on voimakasta.

Leväkasvustoihin ilmestyi kahdenlaisia leväsoluja, joita voisi kuvata uros- ja naarassoluiksi. Niitä molempia tarvitaan suvulliseen lisääntymiseen.

Vaatii kuitenkin vielä lisää tutkimusta, jotta tämä mikrolevien elonkierron vaihe tunnetaan paremmin.

Tällainen selviytymisstrategia voi olla paljon yleisempi yksisoluisten levien keskuudessa kuin aiemmin on ajateltu.

Tutkija Lumi Haraguchin mukaan esimerkiksi Itämerellä mikrolevät joutuvat olosuhteisiin, joissa ne selviytyvät huonosti. Silloin niiden ominaisuudet voivat muuttua ja levät voivat säilyä elossa pidempään.

– Yksisoluisia mikroleviä on tutkittu paljon, mutta se on haasteellista, koska ne ovat erittäin pieniä ja elävät usein vain hyvin lyhyen ajan. Elinkaari on ehkä vain muutaman päivän tai yhden päivän mittainen, Lumi Haraguchi sanoo.

Mikrolevät tuottavat paljon happea ja sitovat runsaasti hiilidioksia

Merissämme elää satoja erilaisia mikroskooppisia levälajeja. Nämä yksisoluiset eliöt tuottavat fotosynteesin avulla noin puolet maapallon hapesta.

Valtamerien mikroskooppiset levät sitovat myös planeettamme hiilidioksidista puolet. Näiden pikkuruisten levien valtavasta globaalista merkityksestä huolimatta tiedämme edelleen hyvin vähän niiden elämästä ja selviytymisstrategioista, esimerkiksi ravintotottumuksista ja lisääntymisestä.

Brasilialainen Lumi Haraguchi on työskennellyt Suomen ympäristökeskuksessa puolitoista vuotta.Sina Wallschuss

Lumi Haraguchi työskentelee nykyään Suomen ympäristökeskuksen merikeskuksessa Suomen Akatemian rahoittamassa SEASINK-hankkeessa. Hänen tutkimusaiheenaan on edelleen kasviplanktonyhteisöjen toiminta ja säätely sekä niiden merkitys merien hiilidioksiditasapainossa.

Mikroleviin liittyvä tutkimus on julkaistu Science Advances -tiedelehdessä. Dimorphism in cryptophytes—The case of Teleaulax amphioxeia/Plagioselmis prolonga and its ecological implications

Lue myös

Mikrolevää kutsutaan "vihreäksi kullaksi" eikä syyttä: mikroleviä käytetään jätevesien puhdistamiseen, bioenergiana ja ravintolisinä

Sinilevät voivat nujertaa superbakteerit

Mikroleväenergiaa kokeillaan jo lentokoneissa

Tukka tummeni ja kotikonnut laajenivat – iso DNA-tutkimus mullistaa kuvaa viikingeistä blondeina skandinaaveina

Fri, 18/09/2020 - 15:35

Vaalea, pitkähiuksinen ja pahansisuinen skandinaavi, joka purjehti kavereittensa kanssa vieraille rannoille lohikäärmeveneellään ja otti armotta, mitä halusi, tappoi, raiskasi ja hävitti.

Sellainen kuva viikingeistä ja heidän ajastaan, noin vuosista 750–1050, elänee monen mielessä edelleen. Todellisuus oli kuitenkin paljon monimutkaisempi, kertoo Nature-lehdessä julkaistu laaja kansainvälinen geenitutkimus. Se osoittaa, ettei viikinki-identiteetti vaatinut skandinaavisia sukujuuria.

Tutkijat analysoivat vainajien perimää hampaista ja luista, joita arkeologit olivat löytäneet haudoista eri puolilta Eurooppaa. Valtaosa tutkituista 442 vainajasta oli viikinkiajalta, mutta rautakautista kuvaa täydentämässä oli näytteitä myös pronssikaudelta ja aina uudelta ajalta asti.

Haudat oli löydetty Skandinavian ja Grönlannin lisäksi Britanniasta, Irlannista, Virosta, Puolasta, Ukrainasta ja Venäjältä. Vainajissa oli sekä aikuisia että lapsia, nuorimmat vain vauvaikäisiä.

– Televisiosta nähdyn ja kirjoista luetun perusteella meillä on mielikuva kiinteästä skandinaavisesta viikinkiyhteisöstä, josta lähdettiin tekemään ryöstöretkiä ja kauppaa pitkin Eurooppaa. Geenit osoittavat heidän maailmastaan muuta, sanoo tutkimusta johtanut evoluutiogeneetikko Erske Willerslev.

Viikinkien todellinen kuva muuttui jopa niin paljon, että historiankirjat on kirjoitettava uusiksi, tuumii Willerslev, Kööpenhaminan ja Cambridgen yliopistojen professori.

Tutkimuksen perusteella tehty kuva viikingistä ja hänen vangistaan eroaa aika lailla siitä, millaisina viikingit on totuttu ajattelemaan.Jin Lyngvild / Cambidgen yliopisto

Kuva viikingeistä monipuolistui, kun analyysit osoittivat, ettei geenivirta kulkenut vain pohjoisesta poispäin, vaan viikinkien skandinaavisille sydänmaille tuli perimää Brittein saarilta, Etelä-Euroopasta ja Aasiasta, jo ennen viikinkiaikaa.

Vaaleat hiukset eivät olleet viikingin ehdoton tunnusmerkki, vaan joukossa oli paljon myös tummatukkaisia.

– Todisteet Etelä-Euroopasta ja Aasiasta tulleesta geenivirrasta sopivat hyvin yhteen muiden viimeaikaisten tutkimusten kanssa, jotka kertovat laajoista yhteyksistä tuonaikaisten ihmisten välillä, sanoo brittiläisen Yorkin yliopiston arkeologi Steve Ashby, joka on erikoistunut juuri viikinkiaikaan.

Viikinkiaika ei ollut pitkä, mutta sen vaikutukset ulottuivat Aasian aroilta Pohjois-Amerikkaan.

– Viikinkien mukana levisivät teknologiat, kieli, uskomukset, tavat ja tottumukset. Syntyi uusia sosio-poliittisia rakenteita. Viikinki-identiteetti ei rajoittunut vain heihin, joilla oli geneettiset juuret Skandinaviassa, summaa tanskalaisen Aarhusin yliopiston arkeologian professori Søren Sindbæk.

Virossa kaatui kymmeniä saman kylän poikia

Yksi vanha harhaluulo, jonka tutkimus kumoaa, on ajatus Skandinaviassa asuneesta yhtenäisestä viikinkikansasta. Geeneistä piirtyi kolme erillistä populaatiota, jotka eivät juuri näytä olleen tekemisissä keskenään ja jotka matkustivatkin valtaosin eri suuntiin.

Geenivirtojen perusteella Englantiin lähdettiin ennen muuta nykyisen Tanskan ja eteläisimmän Ruotsin alueelta. Skotlantiin, Irlantiin, Islantiin ja Grönlantiin purjehtivat pääasiassa nykyisen Norjan asukkaat, ja itään mentiin lähinnä Ruotsista.

Vainajien joukosta hahmottui toisaalta läheisiä sukulaissuhteita. Virossa Saarenmaalla venehautaan päätyneiden epäonnisten ryöstö- tai kenties tunnusteluretkeläisten joukosta paljastui yhden perheen tragedia: jossakin Mälarenjärven ympäristössä jäi perhe suremaan neljää yhden päivän aikana kuollutta poikaansa.

Koska lähes kaikilla muillakin oli varsin samankaltainen perimä, joukon arvellaan olleen saman kylän tai kaupungin poikia. Haudattuja oli 41.

Saarenmaan Salmeen päättynyt matka oli poikkeuksellisen varhainen viikinkiretki. Radiohiiliajoitukset kertovat, että elettiin vasta noin vuotta 750. Salmen hauta on harvinaisuus myös siksi, että se on maailman ainoa laivajoukkohauta – tai oikeammin aluksia on kaksi, löydöt vuosilta 2008 ja 2010.

DNA-tutkimukset puhuvat sen puolesta, että hautaukset olivat samanaikaiset, sanoo Tallinnan yliopiston arkeologi Jüri Peets Viron yleisradioyhtiön ERR:n ja saarenmaalaisen Saarte Hääl -lehden artikkeleissa. Virolaistutkijat ovat aiemmin päätelleet miesten kaatuneen kahden kilpailevan viikinkijoukon yhteenotossa.

Peetsin pettymykseksi hautausten yhtäaikaisuudelle ei löytynyt lisävahvistusta kahden miekankappaleen materiaalin analyyseissä. Jos eri veneistä löytyneet palaset kyettäisiin osoittamaan yhdeksi katkaistuksi miekaksi, se olisi vahva todiste.

Oliko matkalla mukana kuningas?

Miesten miekat ja muut hienot esineet ovat saaneet tutkijat kummastelemaan matkan tarkoitusta. Kullalla ja jalokivillä koristeltu miekka tuskin oli paras mahdollinen käyttöase, puntaroi Peets.

Hypoteesia siitä, että miehet kuuluivat kotiseutunsa eliittiin, vahvistaa heidän poikkeuksellinen pituutensa, keskimäärin yli 175 senttiä. Ravintoa oli siis kasvuiässä ollut riittämiin. Myös heidän hampaansa olivat erinomaisessa kunnossa.

Yhden miehen suusta löytyi viikinkien lautapelin hnefataflin valaanluinen kuningasnappula. Oliko se päätynyt suuhun vahingossa, vai oliko se viesti eritysasemasta? Oliko hän peräti kuningas? Siihen tutkijoilla ei ole ainakaan vielä vastatusta.

Tästä linkistä aukeaa Saarte Hääl -lehden julkaisema 21 kuvan galleria Salmen kaivauksista ja löydöistä.

Varnhemista Etelä-Ruotsista löydetty, Kataksi nimetty nainen oli yksi tutkituista viikingeistä. Länsi-Götanmaan museo

Sukulaisuussuhteita ilmeni muuallakin, kuten kauaksi toisistaan Tanskaan ja Englantiin haudattujen miesten välillä. Heidän DNA:nsa kertoo heidän olleen toisen asteen sukulaisia, siis mahdollisesti velipuolia tai setä ja veljen- tai sisarenpoika.

Tällaisista ison kuvan yksityiskohdista kanadalaisen Simon Fraser -yliopiston arkeologian professroi Mark Collard on erityisen innoissaan.

– Näillä havainnoilla on merkittävää kerrottavaa viikinkiajan sosiaalisista elämästä. Emme olisi koskaan tulleet tietämään näitä yhteyksiä ilman muinais-DNA:ta. Tulokset todellakin osoittavat, millainen merkitys tällä tutkimusmenetelmällä on historian ymmärtämisessä, Collard sanoo.

Viikinkiaikaista perimää on nykyisin kymmenellä prosentilla ruotsalaisista. Briteistä arviolta kuusi prosenttia kantaa vastaavaa muistoa pohjoisesta.

Yksi tutkimuksen tuloksista antaa vinkkiä Skotlannin alkuperäiskansasta pikteistä, jotka sittemmin sulautuivat muuhun skotlantilaisväestöön. Ainoat piktien jättämät kirjoitukset ovat kuvakivien symboleja, joita ei ole kyetty tulkitsemaan.

Roomalaiset kirjoittivat heistä, mutta vihollisen värittyneestä näkökulmasta, sillä piktit panivat ankarasti vastaan valtausyrityksille. Viikinkejäkään he eivät ottaneet avosylin vastaan, mutta joutuivat taipumaan.

Kaksi vuotta sitten skotlantilaisen Aberdeenin yliopiston arkeologit löysivät Burgheadista Koillis-Skotlannista piktien suurimpiin kuuluneen linnoituksen kuuden metrin korkuiset hirsimuurit, jotka olivat palaneet karrelle 900-luvulla viikinkien hyökkäyksessä.

Silti joistakin pikteistäkin tuli viikinkejä. Kahdella Skotlannin pohjoiselta Orkneyn saariryhmältä löytyneellä miehellä oli täysin skotlantilainen DNA, mutta miekat ja muut hautaesineet ehtaa viikinkitavaraa.

– Tämäkin on todiste aivan toisenlaisesta kulttuurisesta suhteesta kuin viikinkien ryöstö- ja raiskausretket, huomauttaa Bristolin yliopiston datatieteilijä Daniel Lawson.

Dorsetista Englannista löytyneessä viikinkien joukkohaudassa oli noin 50 luurankoa, joiden päät oli hakattu irti. Jotkut näistäkin vainajista olivat mukana tutkimuksessa. Dorsetin kreivikuntaneuvosto / Oxford Archelogy

Lue myös:

Home uhkaa ainutlaatuista viikinkilaivalöytöä Norjassa

Kertooko kuuluiva riimukivi kertoo viikinkien ilmastoahdistuksesta?

Töissä tapahtuva seksuaalinen häirintä voi lisätä jopa itsemurhariskiä

Fri, 18/09/2020 - 14:40

Tuore ruotsalaistutkimus vahvistaa tietoa siitä, että seksuaalinen häirintä voi heikentää vakavasti psyykkistä hyvinvointia. Tukholman yliopiston tutkimus selvitti työssä tapahtuvaa häirintää.

Jo aiempien tutkimusten perusteella tiedetään, että työpaikan seksuaalinen häirintä voi lisätä stressiä, sairauspoissaoloja ja esimerkiksi masentuneisuutta.

Laajaan aineistoon perustuvan ruotsalaistutkimuksen mukaan työhön liittyvä seksuaalinen häirintä voi olla merkittävä riskitekijä jopa itsemurhille tai itsemurhayrityksille, sanoo tutkimusta johtanut apulaisprofessori Linda Magnusson Hanson Tukholman yliopiston psykologian laitokselta.

– Toivon, että tulokset osaltaan lisäävät tietoisuutta työpaikan seksuaalisen häirinnän vaikutuksista terveyteen, Linda Magnusson Hanson toteaa Ylelle sähköpostitse.

Magnusson Hansonin mukaan British Medical Journal (BMJ) -tiedelehdessä julkaistu tutkimus on merkittävä siksi, että aihetta on aiemmin tutkittu näin laajoilla aineistoilla vain hyvin vähän.

Ruotsalaistutkimuksen aineistona käytettiin työelämää koskevaa kyselytutkimusta, joka oli toteutettu vuosina 1995–2013. Osallistujina oli yhteensä runsaat 85 000 työikäistä ruotsalaista. Kyselyssä selvitettiin, olivatko vastaajat kokeneet seksuaalista häirintää töissä viimeisimmän vuoden aikana. Siinä ei eroteltu, millaista seksuaalista häirintää vastaajiin oli kohdistunut.

Kyselyllä kerätyt vastaukset yhdistettiin myöhemmin kansallisten rekisterien tietoihin kuolinsyistä ja sairaalakäynneistä.

Häirintää koettiin sekä asiakkaiden taholta että työyhteisön sisällä

Tutkimuksen perusteella niillä, jotka olivat kertoneet kokeneensa seksuaalista häirintää työssään, oli kaksinkertainen todennäköisyys päätyä itsemurhaan kuin muilla. Myös itsemurhaa yrittäneillä taustalla oli selkeästi muita vastaajia useammin töissä koettua seksuaalista häirintää. Itsemurha oli 125:n tutkimukseen aiemmin vastanneen henkilön kuolinsyy. Itsemurhayritykseen vastaajista päätyi seuranta-aikana 816 henkilöä.

Linda Magnusson Hansonin mukaan tarvitaan vielä lisää tutkimusta siitä, mitkä tekijät selittävät töissä koetun seksuaalisen häirinnän yhteyttä itsemurhiin ja niiden yrityksiin. Tutkijat eivät voineet täysin sulkea pois sitä, että mielenterveyteen ja esimerkiksi lapsuuden olosuhteisiin liittyvät tekijät selittävät yhteyttä.

– Tuloksia on tulkittava varovaisesti. Silti ne viittaavat vahvasti siihen, että työpaikan seksuaalinen häirintä on riskitekijä itsemurhakäyttäytymiselle, Linda Magnusson Hanson sanoo.

Tutkimuksessa selvitettiin häirintää, jota vastaajat olivat kokeneet työkavereiden ja esimiesten taholta tai toisaalta esimerkiksi asiakas- tai potilaskontakteissa.

– Työpaikan seksuaalinen häirintä kohdistui yleisimmin naisiin ja nuorempiin vastaajiin. Seksuaalisen häirinnän ja itsetuhoisen käyttäytymisen yhteys oli kuitenkin samanlainen naisilla ja miehillä, Linda Magnusson Hanson sanoo.

Magnusson Hanson korostaa, että tutkimus vahvistaa käsitystä huonojen työolojen vaikutuksesta psyykkiseen terveyteen. Työssä tapahtuvasta seksuaalisesta häirinnästä tarvittaisiin hänen mielestään yhä lisää tietoa, että se voidaan nykyistä paremmin työpaikoilla estää.

Keskusteluapua ympäri vuorokauden tarjoaa esimerkiksi Mieli ry:n valtakunnallinen Kriisipuhelin.

Lue lisää:

"Onko kaikki ok?" kysyi Joni Vainio tuntemattomalta ja saattoi pelastaa tämän hengen – toimi näin, jos kohtaat itsemurhaa aikovan

Loppu "kalukuville"? Oikeusministeriö esittää, että roisien kuvien lähettäminen voisi jatkossa olla seksuaalirikos

Kaksimetrinen miesasiakas vainosi Emiliaa ja yritti seurata töistä kotiin – työntekijöiden kokema häirintä yleistyy kaupan alalla

"Ei mua ole koskaan kukaan häirinnyt, jos ei niitä tavallisia juttuja lasketa" – Tottumiskysymys raaputtaa esille arkipäiväisen ahdistelun

Kysely: seksuaalinen häirintä kohdistuu pääosin nuoriin naisiin – asiakkaat suurin häiritsijäryhmä

Monen sivustakatsojan on vaikea tunnistaa ja puuttua seksuaaliseen häirintään – ”Kun itseä ei ole ahdisteltu, empatiakyky on pienempi”

Asiantuntija: EU:n hiilinieluasetuksesta on tulossa löperö yritelmä, joka ei takaa hiilinielujen säilymistä

Fri, 18/09/2020 - 10:07

Hiilinielut eli esimerkiksi metsät ovat toistaiseksi ainoa keino, jolla ihmiskunta pystyy poistamaan ilmastonmuutosta aiheuttavaa hiilidioksidia ilmakehästä.

Siksi EU:ssakin on jo vuosia tahkottu kasaan asetusta, jolla eri maiden hiilinieluja ja niiden kehitystä valvotaan. Niin sanottu LULUCF-asetus näyttää jäävän kuitenkin löperöksi yritykseksi huomioida hakkuiden nieluvaikutukset, sanoo komission asettama riippumaton asiantuntija, Suomen ympäristökeskuksen ryhmäpäällikkö Sampo Soimakallio.

– Ilmasto-ohjaussignaali jää tosi heikoksi. Tosi pieni osa hakkuiden nielua pienentävästä vaikutuksesta tulee tällaisen tilinpidon piiriin, niin että sillä olisi jotain ohjaavaa vaikutusta. Tältä tämä hyvin vahvasti näyttää, Soimakallio sanoo Ylelle.

Jotta asetuksella olisi merkittävästi vaikutusta EU:n ilmastopolitiikkaan, vertailutasot tulisi asettaa siten, että ne luovat vahvemmat kannustimet säilyttää ja lisätä nieluja.

Asetuksen vertailutasot on asetettu siten, että voidaan jopa lisätä hakkuita (vähentää nieluja) ilman, että maa joutuisi löytämään korvaavia nieluja tai vähentämään päästöjä muualla. Vasta tietyn tason ylittävien hakkuiden nielua pienentävä vaikutus tulee merkitykselliseksi laskennassa.

– Tiedämme, että hakkuut pienentävät nielua, joten meidän täytyisi oikeastaan laskea kaikki hakkuiden nielua pienentävät vaikutukset. Muuten laskemme puun käytön täysin hiilineutraalisti, ja se ei luonnontieteellisesti sitä ole, Soimakallio sanoo.

Asetuksen tarkoitus on ollut, että EU-alueen hiilinielut säilyvät, eikä niitä pienennetä.

– EU-tasolla näyttäisi siltä, että hiilinieluja on mahdollista pienentää (siitä vertailukauden tasosta) aika reippaastikin. Se tarkoittaa EU:n ilmastopolitiikan näkökulmasta sitä, että kunnianhimon taso heikkenee.

Hiilinielut nyt isompaan osaan?

Viime ja tällä viikolla julki tulleiden EU:n tiukempien ilmastotavoitteiden myötä, myös hiilinielujen tavoitetta olisi tarkoitus kiristää.

EU-komission puheenjohtaja Ursula von der Leyen esittää uudeksi vuoden 2030 ilmastotavoitteeksi vähintään 55 prosentin vähennystä verrattuna vuoden 1990 päästötasoon. Viime viikolla medialle vuodetun ehdotuksen mukaan varsinaisia päästövähennyksiä olisi tarkoitus tehdä 52 prosenttia ja kolme prosenttia siitä tulisi hiilinielutavoitteen kiristämisestä.

– Tuo kolme prosenttiyksikköä tarkoittaisi ymmärtääkseni noin 150 Mt CO2 EU-tasolla, mikä on samaa suuruusluokkaa kuin se määrä, minkä verran metsien vertailutasot jäävät vertailukauden nieluja alhaisemmaksi, Soimakallio sanoo.

Hiilinielut pystyvät tällä hetkellä sitomaan vain pienen osan Suomen ilmastonmuutosta aiheuttavista kasvihuonekaasupäästöistä.Niko Mannonen / Yle Paljonko metsiä sitten hakataan ja pieneneekö nielu?

EU:n komissio antoi kesällä oman alustavan ehdotuksensa hiilinielujen vertailutasoista kaudelle 2021-2025. Vertailutaso on asetuksen kriteereihin perustuva laskennallinen hiilinielujen taso, jota vasten verrataan kauden toteutuneita hiilinieluja.

Suomi on yksi niistä maista, joilla on ollut suuria vaikeuksia saada hiilinielujen laskentamalli näyttämään toteutuneilla hakkuilla toteutunutta nielua. Luonnonvarakeskus Lukessa on tehty laskentamallille monenlaista kalibrointia, kuten he itse toimenpidettä nimittävät.

– Tähän kalibrointiin on ihan yksiselitteiset ohjeet. Teimme sen komission virkamiesten kanssa yhdessä ja heidän näkemyksen mukaan loppujen lopuksi, sanoo Luken apulaisprofessori Aleksi Lehtonen.

Saaga vertailutasojen kanssa on ollut täynnä erilaisia käänteitä: Professorit ovat varoittaneet, että veronmaksajat joutuvat sellutehdasbuumin maksajiksi, Luke on korjannut pieleen menneitä laskelmiaan ja laskelmissa on väitetty käytetyn väärää korkokantaa.

Soimakallio ihmettelee edelleen komission teknisessä arvioinnissa käytössä olleiden tietojen perusteella Suomen vertailutasolaskentaa.

– Metsänhoitokäytänteiden jatkuminen sellaisena kuin se oli vertailukaudella on asia, joka herättää ihmetystä. Uudistuskypsissä (=riittävän vanhoissa) metsissä näyttää Suomen esityksen mukaan siltä, että puuston määrä per hehtaari pienenee samalla, kun hakkuiden määrä per hehtaari kasvaa. Se herättää kysymyksiä, että kuinka hyvin toteutuneet metsänhoitokäytännöt jatkuvat vertailukaudelta, joka on kuitenkin asetuksen keskeinen prinsiippi. Hirveän vaikea ymmärtää, Soimakallio sanoo.

Lehtosen mukaan EU:n lainsäädäntö sanoo, että metsien vertailutaso tulisi määritellä jaksolle 2021-2030 siten, että metsiä hoidetaan kuten 2000-luvulla.

– Suomi on määritellyt metsänhoidon silloin pinta-alojen kautta, eli kuinka paljon on harvennus- ja päätehakattu. Näin Suomi on sen tehnyt, ja komission virkamiesten mukaan tämä on täysin linjassa lainsäädännön kanssa, Lehtonen sanoo.

Soimakallion mukaan laskelmien olettamuksia muuttamalla voidaan hyvin voimakkaasti vaikuttaa myös lopputulokseen.

– Suurin outous koko ajan on ollut se, että [laskelmissa] hakkuiden suhde pinta-alaan pysyy vakiona, mutta hakkuiden suhde puuston määrään kasvaa oleellisesti. Se herättää kysymyksen, että kuinkakohan hyvin siellä kuvautuu metsänhoitokäytänteiden jatkuminen samanlaisena vertailukaudesta sitoumuskaudelle, Soimakallio sanoo.

Luonnonvarakeskuksen mukaan asetus kyllä ohjaa metsien käyttöä. Toisaalta Lehtosen mukaan asetus ei määritä sitä, miten Suomi metsiään käyttää. Siinä voi ainakin olla suuriakin vuosittaisia vaihteluita.

– Meidän on pakko maankäyttösektorilla (metsät, maatalousmaat, turvetuotanto) miettiä päästövähennyksiä. Vaihtoehtona on se, että maksamme. Kyllä se tulee ohjaamaan. Monelle maalle nämä tavoitteet ovat kunnianhimoiset, Suomi mukaan lukien, Lehtonen sanoo.

Suomen metsien hiilinielu pieneni erityisen paljon vuonna 2018, jolloin metsiämme hakattiin historiallisen paljon.Jouni Immonen / Yle

Aluksi Suomi ehdotti EU:lle, että Suomessa voisi tehdä noin 83 miljoonan kuution verran metsien hakkuita vuodessa, eikä niiden hiilinielua pienentävää vaikutusta silti laskettaisi. Nyt Luken tekemässä korjatussa esityksessä hakkuutaso on 76-77 miljoonaa kuutiota vuodessa.

Jotta asia ei olisi liian yksinkertainen, tämä ei kuitenkaan tarkoita, että se olisi se hakkuutaso, joka todellisuudessa toteuttaisi tämän kyseisen nielun. Vaikka Suomen edustajat ovatkin komission kanssa tämän tason nyt yhdessä määritelleet, Soimakallion mukaan metsiä ei kuitenkaan välttämättä voi hakata näin paljon saavuttaakseen vertailutason. Laskentamallissa oletetulla puuston kasvulla hakkuuvaraa on esitetyn vertailutason saavuttamiseksi Soimakallion mukaan oikeasti noin 70 miljoonaa kuutiota vuodessa.

– Kasvihuonekaasuinventaareissa puuston kasvun ja poistuman välisestä erotuksesta, nielun tasosta ja puutuotteiden nielusta päättelen, että noin 70 olisi sellainen taso.

Luken mukaan metsiämme voidaan hakata tässä mielessä enemmän.

– Hyvin karkea alustava arvio on, että ehkä 72-77 miljoonaa kuutiota. Toki yhden vuoden hakkuut voivat olla paljon suuremmat, jos ne ovat seuraavana vuonna alhaisemmat. Markkinat ohjaavat meillä hakkuita, eikä meillä ole mitään keinoja mikä rajoittaisi tällä hetkellä hakkuita, Luonnonvarakeskuksen Lehtonen sanoo.

Kansallisen metsästrategian mukaan metsiä voi tällä hetkellä hakata maksimissaan 80 miljoonaa kuutiota vuodessa. Jos tähän tähdätään, onko alempaa tasoa vaikea saavuttaa?

– Tämä on hankala kysymys, koska emme tiedä mikä on puun kysyntä, millaisia investointeja Suomeen on tulossa, miten paljon vanhoja tehtaita suljetaan, kuinka paljon puuta tuodaan Venäjältä, Lehtonen sanoo.

Entä riittääkö Suomesta puuta esimerkiksi uusiin sellutehtaisiin näiden nielukiintiöiden puitteissa?

– Sitä on mahdoton arvioida. Riippuu, poistuuko vanhoja tehtaita, Lehtonen sanoo.

Nyt Suomessa hakataan metsää alle 70 miljoonan kuution, pari vuotta sitten oltiin ennätyshakkuissa eli 78 miljoonassa kuutiossa.

– Jos hakkuiden taso olisi tuo ennätykselliset 78 miljoonaa kuutiota vuosi toisensa jälkeen, niin silloin ei uusia sellutehtaita mahtuisi ilman lisäkustannuksia, Lehtonen sanoo.

Toisaalta EU:n hiilinielupolitiikassa noudatetaan viiden vuoden tarkasteluväliä. Viiteen vuoteen mahtuu toisina vuosina enemmän ja toisina vähemmän nieluja pienentäviä hakkuita. Asetuksessa arvioidaan viiden vuoden keskimääräisiä nielutasoja.

Vertailutasoesitys tuo kuitenkin lisäkustannuksen, mikäli hakkuita on viiden vuoden tarkasteluvälillä poikkeuksellisen paljon.

– Jos [hiili]nielumme on vertailutasoa pienempi, joudumme kompensoimaan tekemällä päästövähennyksiä muualla tai ostamaan päästöoikeuksia, Soimakallio sanoo.

Sitä, ovatko metsät jatkossa pienempi vai suurempi hiilinielu kuin nyt, ei voi tietää.

– Riippuu ihan miten metsät kasvavat, paljonko metsiä hakataan, paljonko maankäyttö muuttuu, miten metsiä hoidetaan, millaista taimimateriaalia meillä on, kuinka hoidamme peltoja. Ilmastotavoitteet koskevat koko maankäyttösektoria. Se on niin monen asian summa, että sitä on mahdoton arvioida, Lehtonen sanoo.

Siitä eri laitosten tutkijat ovat kuitenkin samaa mieltä, että maankäyttösektorilla eli metsissä, soilla ja pelloilla on tehtävä päästövähennyksiä.

– Meidän täytyy lisätä nieluja ja vähentää päästöjä. Meillä on siellä monia eri keinoja, joita voidaan toteuttaa; voidaan rakentaa kannustinjärjestelmiä, jotka kannustavat maanomistajia toimimaan aikaisempaa vielä enemmän ilmastoviisaasti. Lehtonen sanoo.

Komissio vahvistaa hiilinielujen vertailutasot lokakuussa. Nyt esillä olevat luvut todennäköisesti pysyvät, koska Suomen edustajat ovat ne komission kanssa yhteistuumin sorvanneet.

Lue myös:

Suomen metsien hiilinielun vertailutasot arvioitu EU:ssa – Komissio julkaisi alustavat ehdotuksensa

Uusi laskelma: Suomessa suunnitellaan jopa 18 miljoonaa kuutiota enemmän metsien hakkuita kuin EU sallii – Miten käy sellutehdashankkeiden?

Suomi voi hakata lisää metsiä ja ilmastotavoitteet täyttyvät silti, kertoo uusi laskelma – tutkijat ja luonnonsuojeluliitto erimielisiä

Selvitys: Vaikka päästöjä vähennetään kaikkialla Suomessa, päästöt eivät vähene

"Ruotsinkieliset eivät päässeet helpommalla" – tutkijat osoittavat vääräksi myytin ruotsinkielisten lipeämisestä evakkojen auttamisessa

Thu, 17/09/2020 - 19:43

Eduskunnassa käytiin kymmenisen vuotta sitten kiivasta keskustelua uudesta ulkomaalaislaista.

MTV:n uutiset otsikoi, kuinka "perussuomalaisten kansanedustaja itketti (maahanmuuttoministeri Astrid) Thorsia karjalaiskysymyksellä".

Esiin oli vedetty niin sanottu karjalaiskortti.

Se on pullahdellut pintaan aika ajoin, kun on haluttu hyökätä maahanmuuttomyönteistä RKP:tä vastaan muistuttamalla ruotsinkielisten haluttomuudesta auttaa Karjalan evakkoja.

Väitteiden mukaan ruotsinkieliset pääsivät muita vähemmällä karjalaisten auttamisesta tai jopa säästyivät kokonaan heidän asuttamiseltaan.

Myytti ruotsinkielisten ja karjalaisten hankalasta suhteesta elää sitkeänä, mutta perusteellista historiantutkimusta aiheesta ei aiemmin ole tehty.

– Ihmisillä on erilaisia käsityksiä, mutta se, mitä todella tapahtui, on ollut hämärän peitossa, sanoo historioitsija Tuomas Tepora.

Teporan ja Aapo Roseliuksen tutkimus _Muukalaisten invaasio. Siirtoväki Suomen ruotsinkielisillä alueilla _tuo nyt valaistusta kiistanalaiseen aiheeseen.

Karjalaiset joutuivat evakkoon kahteen otteeseen: ensin talvisodan jälkeen ja uudestaan jatkosodan päättyessä. Antti Pänkälä / Keski-Suomen museo / Finna Korpeen vai rintamaille?

Karjalaisten evakkojen asutus oli valtava operaatio.

Yli 400 000 ihmiselle piti nopeasti löytää uusi koti sen jälkeen, kun Karjala oli sodan seurauksena jäänyt rajan taa.

Periaatteena oli, että jokainen asutettaisiin mahdollisimman samankaltaisiin oloihin kuin missä he olivat tottuneet elämään Karjalassa.

Kaupunkilaiset, joita oli vajaa puolet evakoista, hakeutuivat kaupunkeihin.

– Pitkälti omatoimisesti, sanoo Tuomas Tepora.

Varsinaisen pähkinän muodostivat reilu 200 000 maanviljelijää ja heidän perheenjäsentään, joille piti löytää jostain uutta viljelysmaata.

– Kyseessä oli aikamoinen omaisuudensiirto. Valtio, seurakunnat, firmat ja myös yksityiset maanomistajat joutuisivat luovuttamaan viljelysmaata evakoille, Tuomas Tepora sanoo.

Ei olekaan yllättävää, että maanjaon periaatteista syntyi kiistaa.

Maanomistajat tukenaan MTK ja Kokoomus ajoivat linjaa, jonka mukaan pääosa karjalaisten viljelysmaasta oli raivattava korpeen. Käytännössä se olisi tarkoittanut karjalaisten asuttamista Itä- ja Pohjois-Suomeen. Perusteena oli tarve korvata sodassa menetetty viljelymaa ja pelkona pakkoluovutukset.

Karjalaisten etujärjestö, Karjalan liitto, vastusti tätä kiivaasti. Se halusi asuttaa evakot valmiiden peltojen ääreen. Perusteena oli muun muassa se, että evakkojen oli nopeasti päästävä kiinni asuntoon ja työhön. Tuskin korvenraivauskaan innosti.

Tukea se sai Maalaisliitolta, joka oli ollut vahva vaikuttaja Karjalassa. Evakkoasioissa kunnostautuivat muun muassa tulevat kärkipoliitikot Johannes Virolainen ja Veikko Vennamo.

Karjalaisten näkemys voitti ja viljelysmaata alettiin etsiä Etelä-Suomen rintamailta.

"Historioitsijat rakastavat myyttejä." Tuomas Tepora ja Aapo Roselius purkavat myyttiä evakkojen ja ruotsinkielisten suhteesta. Markku Pitkänen / Yle Pyhä ruotsalaismaa on pelastettava

Oman kierteensä maanjakokeskusteluun toi kielikysymys.

Etelä-Suomen suurtiloista merkittävä osa oli ruotsinkielisten omistuksessa. Juuri suurtilat olivat avainasemassa kun pohdittiin, mistä lohkoa evakoille peltotilkkuja.

Pienet, alle 20 hehtaarin tilat, sen sijaan rajattiin jaon ulkopuolelle, minkä seurauksena pientilavaltaiselle ruotsinkieliselle Pohjanmaalle ei evakkoja juurikaan asutettu. Väliaikaisesti heitä siellä tosin oli suuriakin määriä.

Ruotsinkielisten ahdistusta lisäsi pelko ruotsinkielen ja koko suomenruotsalaisen kansanryhmän tulevaisuudesta. Väikkyihän edessä näkymä, jossa tuhannet suomenkieliset karjalaiset asettuisivat taloksi historialliselle ruotsalaisalueelle.

Talvisodan yhteishenki oli pian mennyttä ja pintaan nousi 1930-luvun kielisotaa muistuttanut tilanne.

Ruotsinkieliset kaivoivat naftaliinista idean pyhästä ruotsalaismaasta, svenska jordenista: kielivähemmistön aseman voisi turvata vain maanomistus.

Vastapuolella karjalaiset olivat perinteisesti edustaneet aitosuomalaisia, samoin heidän äänitorvensa Maalaisliitto, jossa ajatus yksikielisestä Suomesta eli vahvana.

Kun evakkojen asuttamisen periaatteita alettiiin sorvata maanhankintalaiksi, RKP vaati siihen kielipykälää. Idea oli se, ettei karjalaisten asutus saisi oleellisesti muuttaa kunnan kielisuhteita.

Taustatukea RKP sai pääministeri J.K. Paasikiveltä, joka oli huolissaan Ruotsin-suhteista. Ruotsissa itänaapurin kielikysymystä seurattiin tarkkaan.

Lopulta RKP sai tahtonsa läpi ja kielipykälä kirjattiin lakiin.

Pääministeri J.K. Paasikivi kannatti ulkopoliittisista syistä kielipykälää, jolla RKP yritti estää ruotsinkielisten kuntien suomalaistumisen.Hufvudstadsbladet / Museoviraston kuvakokoelma Kielipykälän vaikutus oli lopulta pieni

Kielipykälä nostetaan yleensä esiin, kun perustellaan ruotsinkielisten alueiden pääsemistä vähemmällä evakkokysymyksessä.

Tuomas Teporan ja Aapo Roseliuksen mukaan pykälä ei kuitenkaan juurikaan vaikuttanut evakkojen asuttamiseen.

– Ruotsinkielisille alueille asutettiin 13 000 evakkoa. Päälle tulivat vielä ne, jotka oma-aloitteisesti muuttivat kaupunkeihin, Tepora sanoo.

Siirtoväen sijoitussuunnitelman mukaan Uudellemaalle ja Varsinais-Suomeen asutettiin yhteensä reilut 130 000 evakkoa. Ruotsinkielisten kuntien osuus oli siis vajaa kymmenys koko joukosta.

Osuus ei kuulosta suurelta. Tutkijat kuitenkin huomauttavat, että rauhansopimuksen seurauksena iso osa ruotsinkielistä maaseutua siirtyi Neuvostoliitolle, kun Porkkala pakkovuokrattiin.

–Alueelta tuli ruotsinkielisiä evakkoja, jotka piti asuttaa. Samalla katosi maata, jota olisi voitu jakaa. Aluehan kuului maan parhaimpiin viljelysseutuihin, Aapo Roselius selittää.

Neuvostoliitolle vuokrattu Porkkala oli laaja alue, joka ulottui Espoosta Inkooseen. Työväen arkisto / Finna

Tutkijat myös muistuttavat, että maanhankintalakiin sisällytettiin niin sanottu ruotsalaisraivauspykälä. Se velvoitti ruotsinkielisiä maanomistajia raivauttamaan uutta peltoa puolitoistakertaisella summalla luovutettavaan maahan verrattuna. Rahassa mitattuna kielipykälän mukanaan tuoma helpotus kävi lopulta kalliiksi.

– Se, että ruotsinkieliset seudut olisivat päässeet helpommalla, on harhakäsitys, sen me pystymme selkeästi osoittamaan, Aapo Roselius sanoo.

Kielipykälän takia ruotsinkielisille alueille jäi asuttamatta lopulta noin 350 perhettä. Luku esiintyi jo evakkojen asuttamisen voimamiehen Veikko Vennamon laskelmissa.

Onko se sitten paljon vai vähän? Pääministeri Paasikivellä oli asiasta selkeä näkemys.

– Paasikivi ajatteli, että kyse on niin pienestä määrästä, ettei asiasta tarvitse tehdä isoa numeroa. Mutta iso numero siitä tuli, Tuomas Tepora sanoo.

Lue myös:

Kun evakot tulivat 80 vuotta sitten, osa sai hyvän vastaanoton, osa joutui huonosti kohdelluksi ja vaikeni vuosikymmeniksi

Kalliomaalauksista saatiin uutta tietoa Nasan käyttämällä tekniikalla – voiko kallioon kuvattu hahmo olla saamelaisjumalattaren esiäiti?

Thu, 17/09/2020 - 18:05

Kun iisalmelainen lääkärinä työskentelevä Pekka Honkakoski sai muutama vuosi sitten käyttöönsä Nasan käyttämää tekniikkaa, alkoivat kalliomaalausten tarinat aueta aivan uudella tavalla.

Valokuvausta harrastava Honkakoski käytti kalliomaalausten tutkimiseen paitsi tätä arkeologeillekin tuttua, satelliittikuvauksissa käytettyä menetelmää, mutta myös erityistä valotustekniikkaa. Näin kallioista alkoi paljastua uusia tarinoita paljon aiempaa enemmän.

Kun kalliomaalauksia löydettiin näin runsaasti, antoi se sijaa aivan uudenlaisille tulkinnoille.

Pohjoismaiden laajimmat ja vanhimmat ihmisen tekemät kalliomaalaukset ovat 3 500 – 7 000 vuotta vanhoja. Niitä voi löytää esimerkiksi Suomussalmelta, Hossan Värikalliolta sekä Mikkelin Astuvansalmelta. Näiden seutujen kalliomaalauksista on paljastunut teoksia, joita uudenlaisen tekniikan avulla on päästy tulkitsemaan paremmin.

Maalausten hahmoissa ja kuvastoissa voi nähdä samankaltaisuuksia esimerkiksi saamelaisten rumpujen kuviin.

Lue myös: Tutkimusmatkailija löysi Hossasta lisää kalliomaalauksia – hyödynsi NASAn menetelmiä

Voisiko kuvassa olla jumalatar Juksáhkkán esivanhempi?

Kalliomaalauksia tulkitessa kannattaa pitää mielessä, että kyseessä on tuhansia vuosia vanhoja teoksia aivan erilaisen kulttuurin aikakaudelta. Tulkinnoissa on Honkakosken mukaan pyöräytettävä omia ajatuksiaan lapsen ajattelutapaan, etteivät nykyiset tiedot ja ajatukset liikaa vääristäisi tulkintoja.

Honkakoski on pitkän linjan valokuvausharrastaja, joka on erityisen kiinnostunut harvinaisemmista kuvauskohteista, niin lumihiutaileista kuin juuri kalliomaalauksista. Honkakoski on omien sanojensa mukaan tutkimusmatkailija ja häntä kiehtovat usein sellaiset paikat, joihin ihan jokainen valokuvaaja ei välttämättä päädy.

Pekka Honkakoski Suomen suurimmassa luolastossa Repouurossa, Kolilla.Pekka Honkakoski

Honkakoski havaitsi löytämissään maalauksissa hahmon, joka muistuttaa saamelaisrummuissa esiintyvää metsästyksen jumalatar Juksáhkkáá. Hahmo innosti häntä perehtymään saamelaiseen historiaan ja nykyaikaan.

– Kielitieteilijät arvioivat kalliomaalauksia tehneiden ihmisten puhuneen jotakin paleoeurooppalaista kieltä, koska saamen- ja suomen kielet olisivat heidän mielestään maalauksia nuorempia, kertoo Honkakoski.

Hän huomauttaa, että saamelaisten historiasta on arkeologista tietoa vasta 2 000 vuotta näitä maalauksia myöhemmin. Silti, jos nyt löydetyistä kalliomaalauksista ja jo aiemmin tiedetyistä asioista löydetään yhteneväisyyksiä, ovat tulokset Honkakosken mukaan erittäin tärkeitä.

Hän heittääkin haasteen tutkijoille: on heidän työnsä tutkia, mistä oikeasti on kyse.

– Onko jonkinlaista historiaa jäänyt unholaan tai onko kallioita maalanneiden ihmisten kulttuurista jäänyt jotain saamelaisten rumpujen kuviin? Jos näiden tietojen välissä on jonkinlainen linkki, toivoisin, että saamelaiset saisivat omaa esihistoriaansa paremmin esiin. Juuri nyt on suomalaisten ja saamelaisten tutkijoiden aika perehtyä tähän asiaan.

Saamelaismuseon arkeologi näkee monenlaisten tutkimusten mahdollisuuden

Saamelaismuseo Siidan arkeologi Eija Ojanlatva arvostaa Honkakosken tekemää työtä. Arkeologien keskuudessa puhetta uusista löydöksistä on hänen mukaansa riittänyt. Ojanlatva on vakuuttunut siitä, että Honkakosken uusi tutkimustapa ja uudet kuvat ovat tutkimusmaailmalle merkittäviä. Kyse on kalliomaalauksista, jotka ovat pitkältä aikaväliltä, yli 3 000 vuoden ajalta.

Saamelaismuseo Siidan arkeologi Eija Ojanlatva pitää uutta dokumentaatiota kalliomaalauksista tärkeänä ja näkee monenlaisten tutkimusten mahdollisuuden.Vesa Toppari / Yle

Suomessa kalliomaalauksia on suhteellisen paljon. Jos tarkastelee laajempaa aluetta esimerkiksi Norjaan ja Venäjälle saakka, on uusissa löydöksissä yhtäläisyyksiä näistä maista löydettyjen kalliomaalausten kanssa.

Kalliomaalauksista on aiemminkin ilmennyt kuvia, jotka ovat tuttuja saamelaismytologiasta: eläimiä, tuntureita, lintuja, ihmisiä metsästystä, kalastusta ja niin edelleen, luettelee Ojanlatva.

Hän lisää, että koko arktisen alueen maalausten tutkiminen olisi mielenkiintoista. Esimerkiksi kivikautisia maalauksia voitaisiin verrata 200 vuotta vanhoihin saamelaisrumpuihin. Jos jokin taho alkaa tutkimaan kalliomaalauksia, toivoisi Ojanlatva saamelaismuseon voivan olla työssä avuksi. Hän näkee saamelaisalueelta tulevan tiedon tärkeäksi osaksi mahdollista tutkimustyötä.

Arkeologian dosentti: kuvien ajatusmaailma näkyy myös saamelaisrummuissa

Kalliomaalauksista väitöskirjan tehnyt arkeologian dosentti Antti Lahelma on aiemmin tuonut esiin ajatuksen siitä, että vanhojen saamelaisrumpujen kuvamaailmassa on voinut säilyä jotain kalliomaalausajan kulttuurin ajattelutavoista. Pekka Honkakosken kokoama uusi dokumentaatio tukee Lahelman näkemystä.

Lahelman mukaan Honkakosken löydökset ovat mielenkiintoisia: osa on ollut tiedossa jo ennen, mutta osa tulkinnoista on aivan uusia.

– Kuvat ovat yhtäläisiä esimerkiksi Juksáhkkán kanssa, mutta se ei tarkoita sitä, että kuvien tekijät olisivat olleet saamelaisia tai saamelaisuutta olisi edes ollut silloin. Ei ole myöskään tietoa siitä, mitä kieltä he ovat puhuneet, kertoo Lahelma.

Honkakoski on vertaillut ruotsalaisen etnografi Ernst Mankerin dokumentoimaa rumpua (vasemmalla) ja Värikalliolta löytynyttä kalliomaalausta (oikealla). Kalliomaalaus on vahvistettu digitaalisesti mustalla värillä.Pekka Honkakoski

– Olivat ne sitte mitä tahansa ihmisiä ja puhuneet mitä tahansa kieltä, on maailmankuvassa sellaisia ominaisuuksia, joita on myöhemmin nähty saamelaisessa uskossa, hän jatkaa.

Lahelma kuitenkin muistuttaa, että kyse on monia tuhansia vuosia vanhoista maalauksista. Vaikka yhteneväisyyksistä saamelaisten kuvausten kanssa puhutaankin, ei voida sanoa, että nämä kalliomaalaukset olisivat saamelaiskulttuurista – toisin kuin vaikkapa rummuissa, joissa yhteys on voitu selvittää.

Lahelma suositteleekin ajattelemaan näitä maalauksia ikään kuin ihmiskunnan yhteisenä perintönä, eikä niitä kannata viedä hänen mukaansa poliittiseen kontekstiin lainkaan.

Biodiversiteetti kuihtuu, mutta uusia lajeja löytyy jatkuvasti

Wed, 16/09/2020 - 05:15

Juuri julkaistut raportit kertovat karua kieltään luonnon köyhtymisestä. Uhanalaisia eliölajeja on entistä enemmän, lintukannat ovat huvenneet vuosikymmenten kuluessa. Väestönkasvu uhkaa ympäristöjä ja kulutuksemme vaatisi kaksi maapalloa ollakseen kestävää.

Biodiversiteetillä on oma yksikkönsä Turun yliopistossa ja sitä johtaa professori Ilari Sääksjärvi. Hänen yksikköönsä kuuluu muun muassa suosittu Ruissalossa sijaitseva kasvitieteellinen puutarha. Sen trooppisessa lämmössä professori mietti luonnon köyhtymistä.

– Luonnon monimuotoisuus voi eri puolilla maailmaa aika heikosti tällä hetkellä ja lajeja kuolee sukupuuttoon. Se riski on yhä suurempi, Sääksjärvi summailee.

Raporttien viesti on ollut synkkä jo pitkään. Toisaalta niissä annetaan myös toivoa.

– Peli ei suinkaan ole menetetty. Meillä on työkaluja, joilla tilannetta voi parantaa. Nyt täytyy vain ottaa ne työkalut tarpeeksi nopeasti käyttöön, biodiversiteettiprofessori sanoo.

YK:n tiistaina julkaisemassa maailman biodiversiteetin tila -raportissa verrattiin kehitystä kymmenen vuotta sitten asetettuihin 20:een Aichi-tavoitteisiin.

– Mikään tavoite ei ole toteutunut kokonaan. Se on tietysti aika pelottava tilanne. Tärkeää on huomata, että kyllä siellä niitä hyviä valonpilkahduksia on, Ilari Sääksjärvi sanoo.

Hän nostaa esiin sen, että ihmisten tietoisuus luonnon monimuotoisuudesta on lisääntynyt kymmenen vuoden aikana huomattavasti. Nyt ymmärretään biodiversiteetin olemus ja merkitys.

Professori Ilari Sääksjärvi johtaa Turun yliopiston biodiversiteettiyksikköä.Markku Sandell / Yle

– Hyviäkin esimerkkejä on, mutta toisaalta myös pelottavaa se, että yhdessä asetettuja tavoitteita ei ole saavutettu.

Uusia lajeja löytyy kuitenkin edelleen

Professori Ilari Sääksjärven ryhmä on tutkinut paljon Etelä-Amerikan Amazonian aluetta. Tilanne siellä on kehittynyt koko ajan huonompaan suuntaan, kun sademetsiä häviää maanviljelyn, teiden ja kaivostoiminnan takia.

Vuodesta 1970 alkoi Amazoniassa hurja kehitys, jossa isojen teiden ja infrahankkeiden rakentaminen aloitti metsien tuhoutumisen.

– Viimeisen 50 vuoden aikana Amazoniassa on tapahtunut hurjia asioita ja se varmasti heijastuu koko latinalaista Amerikkaa koskeviin lukuihin, biodiversiteettiprofessori arvioi.

Sademetsien tuhoutuminen hävittää eri lajien elinympäristöjä ja Sääksjärvi pelkää, että tieteelle aiemmin tuntemattomia eliölajeja tuhoutuu peruuttamattomasti. Jatkuvasti tutkijat kuvaavat uusia lajeja, joita löytyy ympäri maailmaa.

– Tämä vuosi on omalle tutkimusryhmälleni todella hyvä vuosi. Olemme kuvanneet ja nimenneet noin 50 tieteelle uutta eläinlajia eri puolilta maapalloa. Luulen, että sadan rajapyykki tulee tänä vuonna vastaan, Ilari Sääksjärvi laskeskelee.

Tämä on vain murto-osa siitä, kuinka paljon uusia eläinlajeja löydetään. Turun yliopiston biodiversiteettiyksikön laboratoriossa on professorin mukaan satoja tieteelle tuntemattomia eläinlajeja, jotka odottavat kuvaamista ja oman tarinansa kertomista.

– Näiden lajien kautta haluamme kiinnittää ihmisten huomiota siihen, kuinka ainutlaatuisia paikkoja myös tuhoutuu tällä hetkellä maailmalla. Katsokaa hei, kuinka upeita lajeja sieltä löytyy!

Sääksjärven oma tutkimusryhmä on keskittynyt pistiäisiin ja muihin niveljalkaisiin, mutta viimeisten vuosien aikana on löytynyt jopa satoja kiloja painavia uusia eläinlajeja. Näitä tavataan alueilta, missä tieteellistä tutkimusta on tehty vähän.

Pienetkin lajit ovat silti mielenkiintoisia, kuten tänä vuonna tieteelle vertaisarvioidusti kuvattu Perun Pucallpan kaupungin liepeiltä löydetty loispistiäinen.

Hymenoepimecis pucallpina -laji löytyi Perun Amazoniasta läheltä Pucallpan joenvarsikaupunkia. Suvun lajit loisivat hämähäkkejä, ja ne pystyvät manipuloimaan isäntähämähäkin käyttäytymistä monimutkaisella tavalla. Toisen lajin käyttäytymisen manipulointi on luonnossa harvinaista, mikä tekee lajilöydöstä erityisen mielenkiintoisen.Kari Kaunisto, Turun yliopiston biodiversiteettiyksikkö

Kemiallisesti toisia lajeja manipuloiva loispistiäinen herättää mielenkiintoisia ajatuksia siitä, voisiko niiden käyttämiä yhdisteitä hyödyntää lääketieteellisissä tutkimuksissa. Pienilläkin lajeilla voi Sääksjärven mukaan olla paljon kerrottavaa meille.

– Olemme kuvanneet useita pistiäislajeja ympäri maailmaa ja valtavasti hämähäkkejä erityisesti Lähi-Idän alueelta. Ryhmämme selkärankaisia lajeja tutkivat ovat löytäneet viime vuosina esimerkiksi tieteelle tuntemattomia sammakko- ja matelijalajeja.

Riskit tunnetaan, mutta suojelu vaatii konkreettisia toimia

Vaikka Turun yliopiston biodiversiteettiyksikön johtajana työskentelevä Ilari Sääksjärvi iloitsee tutkijaryhmänsä työn tuloksista, niin häntä huolestuttaa luonnon monimuotoisuuden jatkuva ja nopea köyhtyminen.

– Tilanteesta tekee ehkä vielä pelottavamman jo pelkkä ajatus siitä, kuinka paljon me menetämme lajeja ennen kuin edes löydämme niitä tieteelle.

Jokaisella lajilla on oma lokeronsa luonnon ekosysteemeissä. Niillä voisi olla myös hyötyä

– On syytä muistaa, että luonnon monimuotoisuuden suojelussa, suojelemme paitsi luonnon monimuotoisuutta myös ihmiskuntaa osana sitä, Sääksjärvi muistuttaa.

Luonnon tuhoutumisen taustalla Ilari Sääksjärvi näkee syiksi ihmiskunnan nopean väestönkasvun. Luonnonvaroja käytetään säälimättä. Elinympäristöt rapautuvat, kalakantoja ylikalastetaan, uhanalaisia lajeja metsästetään.

Ilmastonmuutos vaikuttaa moniin lajeihin ja tulee hävittämään niitä sukupuuttoon. Ympäristöä saastutetaan edelleen ja puhdistamattomia jätevesiä lasketaan luontoon. Mikromuovisaastetta on paljon ja ihmistoiminnan kautta vieraslajeja leviää uusille alueille uhkaamaan alkuperäislajeja.

– Kaikki nämä syyt mainitaan biodiversiteettiraporteissa ja niistä ollaan yksimielisiä. Mutta nämä ovat kaikki asioita, joihin voimme vaikuttaa ja joiden parantamiseksi on jo olemassa työkaluja. Se antaa toivoa tälle tilanteelle, sanoo professori Ilari Sääksjärvi.

The Guardianin artikkelissa kerrotaan, miten suojelutoimilla on saatu estettyä kymmenien lintu- ja eläinlajien sukupuutto.

Kuusi uutta sienilajia löytynyt Suomesta

Tutkijaryhmä on julkaissut tiedot kuudesta Suomessa uudesta sienilajista. Lajit kuuluvat sieniluokittelussa kääväkkäisiin ja ne kasvavat kuolleella puuaineksella. Löydöt on tehty eri puolilla Suomea lajistoselvitysten yhteydessä. Nämä kuusi Suomelle uutta sienilajia eivät vielä ole saaneet suomenkielisiä nimiä.

Kuvassa Helicogloea sebacea -sieni, joka löydettiin Hyrynsalmelta. Muut tänä vuonna Suomesta löydetyt sienilajit ovat Phanerochaete cremeo-ochracea (löytöpaikka: Luhanka), Spiculogloea subminuta (Kuhmo ja Inari), Steccherinum cremeoalbum (Turku), Typhula suecica (Virolahti) ja Uncobasidium luteolum (Luhanka)Teppo Helo

Kaksi näistä löydöistä teki kajaanilainen luontokartoittaja Teppo Helo ja kaksi helsinkiläinen sienitieteen dosentti Heikki Kotiranta.

Useimmat löydöistä on tehty viime vuosina aikana. uusien lajien havaitseminen kertoo ennen kaikkea lisääntyneestä kenttätutkimuksesta.

Kaikista näistä sienilajeista on aiempia löytöjä muualta Euroopasta, mutta niiden elinympäristövaatimukset tunnetaan huonosti. Useat näistä sienilajeista kasvoivat Suomessa ohuella lehtipuulla.

– Nämä löydöt osoittavat, että Suomen luonnossa on vielä paljon tutkittavaa. Lisäksi havainnot vain vahvistavat tietoa, että kaikenlaisen lahopuun säästäminen on luonnon monimuotoisuuden suojelun kannalta tärkeää, kertoo julkaisutyötä koordinoinut maatalous- ja metsätieteiden tohtori Panu Kunttu.

Spiculogloea subminuta -sieni löytyi Inarista.Teppo Helo

Havainnot raportoitiin sienitieteellisissä Acta Mycologica ja Karstenia -julkaisusarjoissa.

Lue myös

Ihmiskunta tienristeyksessä – YK:n jättiraportti maapallon tilasta: Tarvitaan kahdeksan massiivista muutosta luonnon tuhon pysäyttämiseksi

Nämä eläinlajit kuolivat elinaikanasi – teimme muistokirjoitukset kadonneille eläimille

WWF:n uusi raportti: Selkärankaisten eläinten populaatiot kutistuneet erittäin hälyttävästi – Latinalaisessa Amerikassa lajien yksilömäärät ovat pienentyneet 94 prosenttia

Sukupuutto vei okakrotin – eviensä avulla pohjassa taapertanut laji on ensimmäinen merikala, joka on julistettu hävinneeksi meidän aikanamme

Mertensuojelun supervuosi kuivahti koronaviruksen takia – merten armonajaksi lasketaan kymmenen vuotta

Ihmiskunta tienristeyksessä – YK:n jättiraportti maapallon tilasta: Tarvitaan kahdeksan massiivista muutosta luonnon tuhon pysäyttämiseksi

Tue, 15/09/2020 - 16:15

“Ihmiskunta seisoo nyt tien risteyksessä sen päätöksen kanssa, millaisen perinnön haluamme jättää tuleville sukupolville.”

Näin kuvaa YK:n biodiversiteettisopimuksen pääsihteeri Elizabeth Maruma Mrema tänään julkaistun jättimäisen biodiversiteettiraportin esipuheessa sitä miten ratkaisevia hetkiä juuri nyt elämme maapallon luonnon, eliö- ja eläinlajien sekä koko ekosysteemien pelastamiseksi.

YK:n viidennen biodiversiteettiraportin mukaan luonnon suojeleminen sinällään ei riitä. Tarvitaan massiivisia taloudellisia, sosiaalisia, poliittisia ja teknisiä muutoksia, jotta maapallon luonto saadaan käännettyä oikealle kurssille.

Raportin keskeiset viestit ovat:

  • Vuonna 2010 asetetuista 20 luonnon monimuotoisuuden suojelutavoitteesta vain kuusi on saavutettu osittain vuoden 2020 takarajaan mennessä, yksikään ei kokonaan
  • Kahdeksan eri massiivista muutosta pitää hidastua, jotta luonnon kiihtyvä rappeutuminen saadaan pysäytettyä
  • Raportti summaa, mitä kiireellisiä toimia tarvitaan tästä eteenpäin
  • Iloisiakin uutisia on: Suojelulla on pystytty estämään lajien sukupuuttoja, suojelualueiden määrä maa- ja merialueilla on lisääntynyt ja kalakannat ovat elpyneet vesialueilla, joilla kalastus on kestävällä pohjalla.

Huolimatta suojelutoimien valonpilkahduksista ja joidenkin lajien parantuneesta tilanteesta, maapallon luonto kärsii pahasti ja tilanne pahenee.

– Monia hyviä asioita tapahtuu, ja niistä kannattaa iloita. Joka tapauksessa biodiversiteetin hupenemistahti on ennennäkemätön ihmiskunnan historiassa, ja paineet voimistuvat. Maapallon elämänmuodot kokonaisuudessaan on vaarannettu, Mrema sanoo raportissa.

Toimenpiteet, joita hallitukset ovat tehneet, ovat oikeansuuntaisia, mutta täysin riittämättömiä, sanoo myös Suomen luontopaneelin puheenjohtaja, Jyväskylän yliopiston ekologian professori Janne Kotiaho.

– Sillä määrällä toimenpiteitä mitä on tehty ei päästä kovin pitkälle.

Kun luonto taantuu, Mreman mukaan koronaviruksen kaltaiset taudit saavat uusia mahdollisuuksia levittäytyä ihmisiin ja eläimiin.

– Aikaa on käytettävissä vähän, mutta pandemia on osoittanut, että massiiviset muutokset ovat mahdollisia, kun niitä on pakko tehdä.

Global Biodiversity Outlook -raportti luonnon monimuotoisuudesta, lajien tilanteesta ja tarvittavista toimista luonnon pelastamiseksi on verrattavissa IPCC:n raportteihin ilmastonmuutoksesta. Se antaa kattavan kuvan maapallon luonnon tilasta.

Savannikorppikotka (Gyps africanus) on afrikkalainen haaskoja syövä petolintu. Se on äärimmäisen uhanalainen eli sillä on erittäin suuri välitön uhka hävitä luonnosta.Joel Sartore / National Geographic Photo Ark Ihmisten toiminnot pitää panna uusiksi

YK:n raportti vaatii, että “business as usual” ei voi enää jatkua suuressa osassa ihmisten toimintoja. Se varoittaa, että tarvitaan kahdeksaa massiivista muutosta, jotta turvataan ihmisten hyvinvointi ja pelastetaan planeetta.

Kaikki kahdeksan muutosta huomioivat luonnon monimuotoisuuden arvon ja tarpeen korjata ekosysteemejä. Kaikki ihmistoiminta on niistä riippuvaista.

Mikään korjausliike ei yksin saa YK:n raportin mukaan luonnon köyhtymistä pysähtymään. Kaikki toimet yhdessä tarvitaan, jotta maapallon luonto elpyy ja se mitä siitä on jäljellä, saadaan voimaan paremmin.Jyrki Lyytikkä / Yle

Kahdeksan muutosta:

  1. Maa ja metsät: Tarvitaan koskemattomien ekosysteemien, kuten ikimetsien, suojelua, kärsivien metsäekosysteemien ennallistamista, taistelua luonnon rappeutumista vastaan ja satelliittitason suunnittelutyökalujen käyttöä, jotta vältetään, vähennetään ja sopeutetaan maankäytön muutoksia.
  2. Kestävä maatalous: Maatalouden toiminnot on muotoiltava uudelleen agroekologian eli esimerkiksi ruokajärjestelmien kestävyyden peruskysymysten ja muiden innovatiivisten lähestymistapojen avulla, joilla lisätään tuottavuutta ja vähennetään negatiivisia vaikutuksia biodiversiteettiin.
  3. Kestävä ruokajärjestelmä: Kestävät ja terveelliset ruokavaliot pitää mahdollistaa ja ohjata ihmisiä pääasiassa kasvisruuan syömiseen ja lihan ja kalan maltilliseen käyttöön. Myös ruokahävikin dramaattinen pienentäminen ruoan toimitusketjussa sekä kulutuksessa on välttämätöntä.
  4. Kestävä kalastus ja meret: Merien ja rannikoiden ekosysteemiejä pitää suojella ja ennallistaa. On jälleenrakennettava muun muassa kalastusjärjestelmät ja vesiviljely, jotka takaavat merten ja kalakantojen kestävän käytön ja lisäävät ruokaturvaa ja elinkeinoja.
  5. Kaupungit ja infrastruktuurit: Otetaan käyttöön “vihreä infrastruktuuri”, tehdään tilaa luonnolle rakennetuissa ympäristöissä, jotta kaupunkilaisten terveys ja elämänlaatu paranevat. Kaupunkien ja infrastruktuurin ympäristöjalanjäljen pienentäminen on myös tärkeää.
  6. Kestävät makean veden alueet: Makean veden alueet (joet ja järvet) tarvitsevat sellaiset yhteneväiset toimet, jotta ihmiset ja luonto voivat elää rinnakkaiseloa näillä alueilla. Se tarkoittaa esimerkiksi veden laadun parantamista, kriittisten elinympäristöjen suojelua, vieraslajien torjuntaa ja vesireittien katkeamattomien yhteyksien takaamista vuoristoista rannikoille.
  7. Kestävät ilmastotoimet: Otetaan käyttöön luontopohjaisia ratkaisuja (yhteiskunnallisten ongelmien ratkaisuja, jotka tukeutuvat luontoon ja tuottavat samanaikaisesti ekologista, sosiaalista ja taloudellista hyötyä). Samaan aikaan ajetaan fossiilisten polttoaineiden käyttö alas ilmastonmuutoksen vaikutusten vähentämiseksi.
  8. One Health: Lähestytään monimuotoisuutta kokonaisvaltaisesti, mikä auttaa sekä ekosysteemejä että ihmisiä voimaan hyvin. Luonnon monimuotoisuudella ja ihmisten terveydellä on monia kytköksiä toisiinsa.
Punasusi (Canis rufus) hävisi jo kertaalleen luonnosta 1980-luvulla metsästyksen ja elinalueen supistumisen takia, mutta suojelutoimilla se on saatu taas luontoon takaisin. Yhdysvaltain itäosissa elävä punasusi on edelleen äärimmäisen uhanalainen. Kuvan punasusipari elää etelädakotalaisessa Great Plains -eläintarhassa Yhdysvalloissa.Joel Sartore / National Geographic Photo Ark Miksi nämä muutokset?

Ykkösmuutostarpeeksi YK nostaa metsäkadon ja metsien raivauksen vähentämisen. Maankäytön muutokset, kuten metsien raivaaminen pelloiksi, on suurin suora syy maanpäällisten eläin- ja kasvilajien katoon.

Kaikkiaan kolme kahdeksasta suuresta muutostarpeesta liittyy siihen, mitä me ihmiset syömme ja miten ja missä syömäämme ruokaa tuotetaan. Ruuantuotantoon käytetään jopa 3/4 maapallon pinta-alasta.

– Se tarkoitaa sitä, että muilla lajeilla ei enää ole mahdollisuuksia elää näillä alueilla. Sen takia ruuantuotantoon pitää kiinnittää huomiota. Tähän on helppo keino: jos siirrymme enemmän kasviperäiseen ruokaan, voimme vähentää pinta-alaa, mikä käytetään ruuan tuottamiseen. Tällä hetkellä iso osa pinta-alasta menee niiden eläinten ravinnoksi, jotka me sitten syödään, Kotiaho sanoo.

Monimuotoisuuskriisi ja ilmastokriisi tarvitsevat molemmat samanaikaisia toimia, ettei ilmastonmuutos vesitä monimuotoisuuden eteen tehtyjä toimia. Toisaalta ilmastonmuutosta voi estää suojelemalla luontoa.

– Jopa kolmasosa tarvittavista päästörajoituksista voidaan saavuttaa suojelemalla ja ennallistamalla luontoa. Eli käytännössä suojelemalla luontoa taklaamme myös ilmastonmuutosta, Kotiaho sanoo.

Luonnon suojeleminen maksaa rahaa

GBO-5-raportin mukaan rahaa biodiversiteetin suojeluun on olemassa kansallisista varoista ja kansainvälisistä kehitysrahoista vuosittain 78-91 miljardia US-dollaria. Arviot siitä paljonko rahaa työhön tarvitaan, liikkuvat vähintään sadoissa miljardeissa dollareissa.

Raportin mukaan luonnon pelastamiseksi käytetyt varat kuitenkin hukkuvat biodiversiteetille haitallisten tukien alle. Tällaisia ovat esimerkiksi 500 miljardin US-dollarin vuosittainen tuki fossiilisille polttoaineille.

Suomessakin voidaan Kotiahon mukaan kysyä, olemmeko täysin tosissamme monimuotoisuuden turvaamisessa.

– Koko ympäristöministeriön hallinnonalan budjetti on noin 300 miljoonaa euroa ja vertailun vuoksi maa- ja metsätalousministeriön 2,5 miljardia. Tässä luonnon turvaamisen budjetissa puhutaan niin pienestä määrästä rahaa, että se pitäisi kolminkertaistaa. Se pitäisi olla miljardi vuodessa, jotta oikeasti päästään tekemään kunnollisia toimenpiteitä ja lopettamaan monimuotoisuuden köyhtyminen, Kotiaho sanoo.

Raportin antia käsitellään ensi vuonna

Ensi vuonna maailman maiden on tarkoitus kokoustaa Kiinassa ja sopia yhteisistä toimista maapallon biodiversiteetin suojelemiseksi. Tämä raportti on merkittävä askel ja pohjatyö kohti tuota kokousta.

– Toivottavasti kokous päätyy ottamaan käyttöön suuntaa muuttavan ja innovatiivisen maailmanlaajuisen biodiversiteettiagendan tälle vuosikymmenelle, Mrema sanoo.

Suojelualueiden määrää maailmassa yritetään nostaa 30 prosenttiin seuraavien 10 vuoden aikana. Se on sellainen määrä pinta-alaa, että sillä suuri osa lajeista pystyisi jo jollain tavalla elämään, Kotiaho sanoo.

– Jos alueiden annetaan kehittyä luonnontilaan pitkän ajan saatossa, olemme tilanteessa, jossa luonto pystyy säilymään täällä pallolla sellaisena, että se turvaa jonkun verran palveluja, joita se meille tuottaa eli hyötyjä, joita me saamme luonnosta. Se on kannatettava tavoite, ja se saattaa riittää.

– Päätöksillä, joita teemme nyt, on perustavaa laatua olevat vaikutukset - hyvään tai pahaan - kaikille lajeille, omamme mukaan lukien, Mrema sanoo.

Lue myös:

WWF:n uusi raportti: Selkärankaisten eläinten populaatiot kutistuneet erittäin hälyttävästi – Latinalaisessa Amerikassa lajien yksilömäärät ovat pienentyneet 94 prosenttia

Maapallon laajuinen analyysi: suojelemalla luontoa suojellaan myös ilmastoa

Maailman maat yrittävät saada lajien sukupuutot loppumaan kansainvälisellä sopimuksella – Suomen neuvottelija: "Jos ei ole lajeja, ei ole elämääkään"

Mertensuojelun supervuosi kuivahti koronaviruksen takia – merten armonajaksi lasketaan kymmenen vuotta

Tutkimus: Talouskasvu syö luonnon monimuotoisuutta Suomessa – Nyt biodiversiteetin köyhtyminen voidaan pysäyttää

Näiden kuuden lajin suojeleminen voisi estää Suomen luonnon köyhtymisen – "Ei luonnon monimuotoisuuden pelastaminen ole vaikeaa"

Uusi arviointi: Joka yhdeksäs Suomen eliölajeista on uhanalainen – varsinkin monille lintulajeille voidaan sanoa pian heippa

Jutun kuvat ovat The National Geographic Photo Ark:sta, jonka perustaja Joel Sartore on kuvannut tähän mennessä reilut 10 000 lajia inspiroimaan ihmisiä lajien suojeluun.

Hämmästyttävä löytö: Venuksessa merkkejä elämästä – Toistaiseksi vakuuttavin todiste elämästä muualla kuin maapallolla

Mon, 14/09/2020 - 18:00

Kansainvälisen tutkijaryhmän mukaan Venusta peittävissä pilvissä on kemiallista yhdistettä, fosfiinia, jonka olemassaolo voidaan selittää ainoastaan pilvissä olevalla yksinkertaisella elämällä.

Luonnossa oleva fosfiini on peräisin joko happamissa, vähän happea sisältävissä olosuhteissa olevista mikrobeista tai se on keinotekoisesti valmistettua.

Kyseessä on toistaiseksi vakuuttavin todiste elämästä muualla kuin maapallolla. Tutkijat kertovat asiasta tänään maanantaina julkaisemassaan artikkelissa.

Fosforista ja vedystä koostuvat fosfiinimolekyylit leijuvat Venuksen kaasukehässä. Tutkijat olettavat, että fosfiini syntyy pilvissä olevan mikrobitoiminnan aineenvaihdunnassa.M. Kornmesser / ESO

Tässä vastaukset viiteen kiinnostavaan kysymykseen aiheesta:

1. Mitä on elämä?

Yksinkertaisimmillaan elämä on yhdestä tai useammasta solusta koostuva olio, joka pystyy kasvamaan, lisääntymään ja kehittymään. Sillä on aineenvaihduntaa, ja se syntyy ja kuolee.

Elämää voi syntyä sopivissa olosuhteissa pitkän ajan kuluessa. Varhaisimmat merkit elämästä maapallolla ovat noin neljän miljardin vuoden takaa, eli noin tuhat miljoonaa vuotta sen jälkeen, kun aurinkokunta ja maapallo tiivistyivät tähtienvälisestä kaasupilvestä.

Australian luoteisosista Pilbaran autiomaasta on löydetty niin sanottuja stromatoliitteja, mineraalipinnalle kerääntyneitä bakteerikasvustoja, jotka ovat 3,48 miljardia vuotta vanhoja.

Kanadan Nuvvuagittuqista on löydetty jotakuinkin saman ikäisiä bakteerien kaltaisia hematiittiputkia.

Kummatkin ovat eräänlaisia elämän esiasteita, joista nykyisenkaltainen biologinen runsaus on voinut kehittyä hitaasti vuosimiljardien kuluessa.

2. Missä kaikkialla aurinkokunnassa voisi olla elämää?

Tällä hetkellä tunnemme vain yhden paikan maailmankaikkeudessa, missä on elämää: maapallon. Planeetallamme on mikrobeita, sieniä, kasveja, eläimiä ja arkkieliöitä kaikkialla.

Euroopan avaruusjärjestön Venus Express tutki Venusta ja sen kaasukehää yhdeksän vuoden ajan vuoteen 2014 saakka ja kuvasi myös sen pilvikerrosta. Se ei kuitenkaan tehnyt tarkkoja havaintoja pilvissä olevista molekyyleistä. ESA

Olosuhteet Maassa – ja myös Marsissa – olivat noin 3,5 miljardia vuotta sitten otolliset elämän kehittymiseen. Oli vapaasti virtaavaa vettä, kaasukehä, sopiva lämpötila, elämän vaatimia hiiliyhdisteitä ja energiaa. Hiiliyhdisteet yhtyivät orgaanisiksi aineiksi, jotka kehittyivät elämäksi.

Mars on sittemmin kuivunut ja muuttunut asuinkelvottomaksi, mutta mahdollisesti sen pinnan alla on edelleen paikkoja, missä voisi olla yksinkertaista elämää. Sieltä saattaa löytyä myös merkkejä aikanaan olleesta elämästä, kenties jopa fossiileita.

Muita mahdollisia paikkoja voisivat olla Jupiterin jäisten kuiden pinnan alla kenties olevat meret. Muun muassa komeetoista ja Saturnuksen Titan-kuusta on löydetty orgaanisia yhdisteitä.

3. Kuinka ihmeessä Venuksessa voi olla elämää?

Myös Venus on ollut mukana elämänetsijöiden listalla, mutta silti nyt tehty havainto on yllätys.

Olosuhteet Venuksen pinnalla ovat kaameat: planeettaa peittää paksu pilvikerros, sen pinnalla on yli 450°C:n lämpötila ja siellä sataa rikkihappoa.

Olosuhteet Venuksen pinnalla ovat hurjat. Sieltä on havaittu salamointia ja tulivuoritoimintaa, mutta elämälle Venuksen rikkihapposateiden piiskaama pinta on liian kuuma paikka – ainakin nykyisin.J.Whatmore / ESA

Sen sijaan pilvikerroksessa noin 50 kilometrin korkeudessa lämpötila on noin 30°C. Vaikka siellä on myös erittäin hapanta, voisi siellä olla sellaisiin oloihin sopeutuneita mikrobeja – myös maapallolta tunnetaan happoa kestäviä mikro-organismeja.

Mikrobien leijuminen pilvissä ei ole mikään yllätys. Myös maapallon ilmakehässä ja pilvissä on elämää.

4. Miten havainto tehtiin?

Alkuperäiset havainnot tehtiin kesäkuussa 2017 Havaijilla olevalla James Clerk Maxwell -teleskoopilla. Kyseessä on suurikokoinen alimillimetrialueella toimiva radioteleskooppi, joka soveltuu hyvin erilaisten tähtitieteellisten kohteiden kemiallisen koostumuksen selvittämiseen.

Venuksen kaasukehässä sattui olemaan juuri sopivat olosuhteet, jolloin molekyylejä sisältävät alueet olivat juuri sopivasti alapuolella olevien lämpimien pilvien päällä.

Kun tutkijat huomasivat merkkejä fosfiinista ja ymmärsivät sen mahdollisen merkityksen, tehtiin maailman suurimmalla vastaavalla tutkimuslaitteella, Chilessä sijaitsevalla ALMA:lla lisää havaintoja.

ALMA-teleskooppi tekee havaintoja radioaalloilla, mutta niin tarkasti, että sen avulla voidaan tehdä myös kuva Venuksesta. Tässä ALMA:lla aiemmin otetun Venus-kuvan päälle on laitettu osa James Clerk Maxwell -teleskoopin havaitsemaa spektriä. Spektri on kuin kohteen kemiallinen sormenjälki, ja siinä olevat yksityiskohdat paljastavat mm. fosfiinin.ALMA (ESO/NAOJ/NRAO), Greaves et al. & JCMT (East Asian Observatory)

Havaittu määrä on hyvin pieni, vain noin 20 fosfiinimolekyyliä miljardissa muussa molekyylissä.

Tutkijat kävivätkin seikkaperäisesti läpi erilaisia luontaisia tapoja fosfiinin syntyyn, mutta ei-biologiset prosessit eivät voineet selittää tätä määrää.

5. Mitä merkitystä tällä on?

Toistaiseksi elämää maapallon ulkopuolelta ei ole löydetty suoraan, vaan siitä on vain oletuksia ja epäsuoria merkkejä.

Tähän mennessä vakuuttavin merkki on ollut Marsin pinnalta havaittu tuore metaani, joka voi olla peräisin mikro-organismeista tai tulivuoritoiminnasta. Marsista ei ole havaittu toimivia tulivuoria, mutta koska pinnan alla voi olla vulkaanista toimintaa, on tulivuoriteoria edelleen mahdollinen.

Nyt tehty havainto Venuksesta on sen sijaan hyvin vakuuttava. Tämän perusteella voidaan nyt vakavammin pohtia elämän mahdollisuutta esimerkiksi Jupiterin tai Saturnuksen pilvikerroksessa.

Eri puolilta aurinkokuntaa on havaittu monimutkaisia orgaanisia yhdisteitä, joten elämä voi olla mahdollisesti hyvinkin yleistä. Sitä voi olla myös yllättävissä paikoissa.

"Naisen tehtävä on synnyttää kuusi lasta ja hoitaa kotiliettä" – sota-ajan ankarin propaganda syntyi naistenlehdessä

Sat, 12/09/2020 - 11:17

– Kotiliedessä tapahtui jotain, kun sota alkoi.

Toimittaja Seija Aunila selasi työnsä takia vanhoja Kotiliesiä ja havaitsi muutoksen, jota lehden päätoimittaja Alli Wiherheimo oli kuvannut kalevalaisin vertauksin:

"Ensin Kotiliesi oli Louhi, vahva ja itsellinen. Kun sota syttyi, alkoi uhrautuvan Lemminkäisen äidin kausi."

Kotiliesi oli talvisodan syttyessä maan laajalevikkisin lehti.

Sen päätoimittaja oli tehnyt opinnäytteensä Goebbelsin propagandasta ja hallitsi vaikuttamisen keinot.

Kun Kotiliesi käänsi kurssiaan, sillä oli merkitystä. Kotiliesi muokkasi kotirintaman mielialoja.

– Se, mitä nainen sai ajatella ja tuntea, mitä mieltä asioista piti olla - mallia ei luotu puolustusvoimien tiedotustoimistossa. Se luotiin Kotiliedessä, lehdessä, joka oli kuin ystävä ankarassa arjessa, Aunila kuvailee.

Aunila aloitti seitsenvuotisen tutkimusmatkan, jonka lopputulos, väitöskirja "Kuinka naistenlehdestä tuli osa sotapropagandaa", tarkastetaan lauantaina Jyväskylän yliopistossa.

Toimittaja Seija Aunila on tehnyt väitöstutkimuksen Kotiliesi-lehden sota-ajan numeroista.Markku Pitkänen / Yle Järkiperäisen kotihoidon puolesta

WSOY:n toimitusjohtajalla Jalmari Jäntillä oli kiire. Oli välittömästi käynnistettävä toimet Suomen ensimmäisen naistenlehden perustamiseksi, tai muut ehtivät ensin.

Elettiin vuotta 1922. Maailmalla naistenlehtiä oli ilmestynyt jo pitkään ja Jäntti haki mallia erityisesti ruotsalaisesta Husmodern-lehdestä. Oli luotava perheenemäntien ammattilehti, joka vaali hyvää kotikulttuuria.

Lehteä luotsaamaan palkattiin WSOY:n kielentarkastaja Alli Wiherheimo. Wiherheimolla ei ollut juurikaan toimittajakokemusta, mutta hän oli kielitaitoinen ja hänellä oli näkemys siitä, millainen lehti voisi olla.

Lehden nimestä käytiin keskustelua. Joidenkin mielestä Kotiliesi vei ajatukset liiaksi keittiöön ja kodin piiriin. Lehdelle toivottiin vahvaa yhteiskunnallista painotusta.

– Lehden slogan oli: Järkiperäisen kodinhoidon puolesta. Ajettiin verotuksellisia uudistuksia, kannustettiin kouluttautumaan, vaikuttamaan omiin asioihin, Seija Aunila kertoo.

Kotiliesi veti niin tiukkaa asialinjaa, että kustantaja päätti lopulta perustaa toisenkin naistenlehden. Hopeapeilin rooliksi tuli tarjota naisille seikkailuja ja päiväunia.

Myynnistä kustantajan ei tarvinnut olla huolissaan. Kotilieden tilaajamäärät kasvoivat vuosi vuodelta niin, että 1930-luvun lopussa se ohitti Suomen Kuvalehden maan luetuimpana aikakauslehtenä.

Sitten alkoi sota.

Sota-aikana ilmestyi kolme naistenlehteä. Hopeapeili ja etenkin Eeva eivät sotaa juuri huomioineet, vaan tarjosivat viihdettä ja pakoa ankeasta todellisuudesta. Kunnon perheessä on kuusi lasta

Kotiliesi myöhästyi talvisodasta.

Aikakauslehden saaminen toimituksesta painon kautta julkaisuun ja lukijan pöydälle kesti neljä viikkoa. Kotilieden ensimmäinen "sotanumero" ilmestyi vasta joulun alla 1939.

Se, mikä lähdössä menetettiin, korvattiin pian ankaralla sisällöllä.

Lehti alkoi saarnata sodan oikeutuksen, kansakunnan säilymisen ja uhrimielen puolesta. Poikkipuoliset näkemykset katosivat.

Päätoimittaja Alli Wiherheimo perusti tuekseen neuvottelukunnan, johon hän kutsui hengenheimolaisia muun muassa kirkon piiristä.

Yksi keskeinen vaikuttaja oli vastaperustetun Väestöliiton varapuheenjohtaja Elsa Enäjärvi-Haavio.

– Lehdessä järkytyttiin miestappioista. Suomen kohtalo näytti todella huonolta. Tarvittiin lisää kansalaisia, tutkija Seija Aunila selittää ilmapiiriä.

Kotiliedessä alkoi ilmestyä lapsiluvun lisäämiseen kannustavia artikkeleja. Monilapsisuuden pääarkkitehtina toimi Enäjärvi-Haavio.

Hänen luomaansa ihanneperheeseen kuului kuusi lasta, joten lapsenteko oli syytä aloittaa nuorena. Opiskeluun ei ollut aikaa, vaan siihen alettiin suhtautua karsaasti.

Sen sijaan nuoria naisia kannustettiin avioitumaan sotainvalidien kanssa. Kaikki haluttiin mukaan talkoisiin.

Kaupunkilaiseen elämänmuotoon Kotiliesi oli aina suhtautunut varauksella – sotavuosina naisen ideaaliksi hahmoteltiin pienviljelijäperheen emännyys, jolloin ruokahuolto hoituisi omavaraisperiaatteella.

Vähälapsisia perheitä syytettiin itsekkyydestä ja pelkuruudesta.

– Häkki nuorten naisten ympärillä alkoi olla tosi tiukka, Aunila pohtii Kotilieden sodanaikaista naiskuvaa.

Alli Wiherheimo on suomalaisen lehtimaailman suuri tuntematon.Tyyne Savia 1935 / SKS, Kirjallisuusarkisto Goebbelsin jalanjäljissä

Sota on poikkeustila, jolloin lehdistönvapauden rajat kaventuvat.

Seija Aunilan mukaan Kotiliesi on kuitenkin poikkeusilmiö Suomen sodanaikaisessa lehdistössä. Siitä tuli osa sotapropagandaa, kuten hän väitöstutkimuksensa otsikossa kertoo.

– Näin kattavaa ja tiukkaa ohjeistusta ei näy muussa lehdistössä.

Erityisen jyrkkä ero on Kotilieden ja kahden muun naistenlehden, Hopeapeilin ja Eevan, välillä.

– Etenkin Eeva ja Kotiliesi olivat kuin yö ja päivä. Eeva käänsi selkänsä sodalle ja kertoi eskapistisia tarinoita eksoottisissa maissa seikkailevista sankarittarista.

Kustantaja ei painostanut Kotiliettä, päinvastoin: sen puolesta lehti olisi saanut olla kepeämpi.

Tiukka linja lähti toimituksesta, sen tukena olleesta neuvottelukunnasta ja lopulta päätoimittaja Alli Wiherheimosta.

Wiherheimo oli harras kristitty. Hän näki sodan uskonnotonta Neuvostoliittoa vastaan paitsi taisteluna itsenäisyydestä, myös länsimaisen sivistyksen ja kulttuurin kohtalonkysymyksenä. Kotiliedessä aiheesta saarnasivat erityisesti papit.

Wiherheimo haki mallia natsi-Saksasta, jossa naisen tehtävä oli lähinnä puhdasveristen lasten synnyttäminen.

Wiherheimo oli tehnyt opinnäytteensä propagandaministeri Joseph Goebbelsistä ja hän vieraili Saksassa useasti. Wiherheimo ihaili saksalaista tehokkuutta ja sama asenne välittyi lehden sivuille.

Yksityisesti hän kuitenkin epäili tulevaa.

– Hän tunnistaa natsien epäkristillisyyden. Hän näkee juutalaisvastaisuuden. Hän arvaa Suomen jäävän arjalaiseksi alusmaaksi, jos Saksa voittaa. Hänet valtaa outo ja epämiellyttävä tunne, Seija Aunila sanoo.

Kriittisyys jäi Alli Wiherheimon päiväkirjoihin, lehteen asti se ei päässyt.

Stockmannilla kudotaan sukkia vuonna 1939. Kotiliesi ihaili maatilan emäntää, mutta myös sotaponnistuksiin osallistuvat kaupunkilaissisaret saivat kunniaa. SA-kuva "En ole hauska, eikä lehtikään ole hauska"

Kun sota päättyi, Kotiliesi muuttui taas.

Alli Wiherheimo kutsui sodan jälkeistä aikaa "Ainon ja Kyllikin kaudeksi", itseään toteuttavien naisten ajaksi.

– Kun sota päättyy, se todella päättyy lehdessä. Se oli sota, kansi kiinni, nyt jatkamme eteenpäin, Seija Aunila kuvailee.

Kotilieden naiskuva muuttui moniarvoisemmaksi, vaikkakin heti sodan jälkeen suhtautuminen naisten kouluttautumiseen säilyi kriittisenä.

– Opiskelupaikat oli jätettävä rintamalta palaaville miehille.

Alli Wiherheimo epäili kykyään johtaa Kotiliettä rauhan oloissa.

– Hän tunnisti olevansa karu, ei lainkaan hauska. Lehtikään ei hänen mielestään ollut hauska.

Wiherheimo jatkoi kuitenkin Kotilieden päätoimittajana vielä parikymmentä vuotta aina eläköitymiseensä asti vuonna 1964.

Myös Kotiliesi jatkaa yhä. Lehti täyttää 100 vuotta kahden vuoden päästä.

Sodanaikaisesta missiosta tai Alli Wiherheimon maailmasta lehdessä ei ole enää mitään jäljellä.

– Ne ovat eri lehdet, vaikka nimi on sama, Seija Aunila sanoo.

Lue myös:

Tuhannet siviilit raportoivat toistensa mielialoista sota-aikana

Puoli vuotta pandemiaa – viruksen käyttäytymisessä on yhä niin paljon kysymyksiä, että vauhtisokeus saa tutkijat julkaisemaan jopa aivan roskaa

Fri, 11/09/2020 - 09:44

Puoli vuotta sitten Maailman terveysjärjestö pani hälytyskellonsa moikaamaan havahduttaakseen hallitukset tajuamaan, miten poikkeuksellisesta taudista COVID-19:ssä on kyse. Maaliskuun 11. päivänä WHO:n pääjohtaja Tedros Adhanom Ghebreyesus julisti COVID-19:n pandemiaksi.

Tiedemaailma tunsi vihollisen sisuskalut jo kaksi kuukautta aiemmin. Silloin kiinalaistutkijat olivat julkistaneet Wuhanissa eristetyn SARS-CoV-2-viruksen sekvensoidun genomin eli viruksen perimän. Ensimmäinen tautitapaus oli diagnosoitu joulukuussa.

Ihmisen genomin kirjainjonossa on 3,2 miljardia merkkiä. Niiden sekvensointi vaati toistakymmentä vuotta kansainvälistä työtä. Tulos on avannut ovia ihmisten perinnöllisten sairauksien ymmärtämiselle ja hoidolle.

SARS-CoV-2:lla kirjaimia on alle 30 000. Vanhastaan tunnettujen koronavirusten perusteella tiedettiin myös olettaa, että perimässä tapahtuisi erittäin vähän mutaatioita, jotka vaikuttaisivat viruksen biologisiin ominaisuuksiin.

Höyhensarjan vastustajastako siis on kyse, ja vieläpä sellaisesta, joka ei väistele iskuja? Tutkittukin sitä on valtavasti enemmän kuin mitään muuta virusta. Miksi se silti yhä hämmentää tutkijoita ja houkuttelee antamaan hätiköityjä vastauksia?

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag SARS-CoV-2:n RNA:n kirjainsarja, jonka avulla virus värvää ihmissolun proteiininsa monistajaksi.

Kaikki virukset muuttuvat. SARS-CoV-2:lla muutos on hidasta, vain noin kaksi mutaatiota kuukaudessa. Influenssaviruksella muutosvauhti on yli kaksinkertainen. Vain murto-osa mutaatioista vaikuttaa virusten fenotyyppiin, biologisiin ominaisuuksiin.

SARS-CoV:2 uutteralla sekvensoimisella on pysytty perillä siitä, mitä reittejä tartunnat ovat eri puolille maailmaa kulkeutuneet.

Minkään mutaation ei kuitenkaan ole pitävästi osoitettu muuttaneen perimää niin, että virus olisi muuttunut helpommin tarttuvaksi, saati vakavammaksi.

Virologin silmin virus on biologisesti edelleen ihan sama, joka joulukuussa lähti liikkeelle Wuhanista, sanoo Helsingin yliopiston uhkaavien infektiotautien apulaisprofessori Tarja Sironen.

Hyvin harvalla mutaatiolla on merkitystä

Vastauksia kysymyksiin COVID-19-tilanteen kehittymisestä kaivataan niin kiihkeästi, etteivät ainoastaan media ja sen kuluttajat tee perusteettomia päätelmiä, vaan samaan ovat langenneet monet tutkijatkin.

Tutkijoilla on käynnissä hirveä kilpailu tieteellisistä julkaisuista, sanoo Tarja Sironen.

– Kun jostakin tulee havainto mutaatiosta, siitä saatetaan tehdä tosi huonolaatuisia julkaisuja, joissa sanotaan, että virus on muuttunut. Ja siitä sitten spekuloidaan vähän liikaa.

Suurin osa mutaatioista on virusten kannalta huonoja. Niistä ei ole yleistymään.

– Viruksille on epätarkan kopiointimenetelmänsä takia luonnollista, että mutaatiota syntyy. Harvat kombinaatiot ovat virukselle edullisia ja pääsevät leviämään.

Suurin osa on niin sanottuja hiljaisia mutaatioita. Jokin nukleotidi muuttuu tai ehkä jokin aminohappokin, mutta ei se vaikuta virukseen mitenkään, Sironen kertoo.

Sattumanvaraisuuden vuoksi sekin on toisaalta mahdollista, että SARS-CoV-2:n mutaatiovauhti kiihtyy, jos viruksen proteiineihin sattuu sopiva muutos.

– Tai sattuu syntymään esimerkiksi variantti, joka säilyy elimistön ulkopuolella entistä pitempään. Monenlaiset ominaisuudet vaikuttavat siihen, kuinka hankala ongelma tämä virus on.

Soluviljelmä ei ole ihminen

Kesällä huomiota herättivät tutkimukset, joiden mukaan viruksen piikkiproteiinissa yksi aminohappo on muuttunut toiseksi, minkä pääteltiin kasvattavan tuntuvasti potilaiden viruskuormaa ja suorastaan lisäävän taudin tarttuvuutta.

Mutatoitunut variantti on jopa kymmenen kertaa tartuttavampi kuin se, joka todettiin alkujaan Wuhanissa, pääteltiin Cell-lehdessä julkaistussa kiinalaisessa tutkimuksessa. Vastaavaa esitti yhdysvaltalais-brittiläinen tutkimus niin ikään Cell-lehdessä.

Tiedeyhteisö ei ole täysin vakuuttunut johtopäätöksistä. Laboratoriossa soluviljelyssä saatu tulos ei välttämättä tarkoita ihmisten keskuudessa samaa, kommenteissa huomautetaan.

– Yksi tutkija sanoi mielestäni hirveän hyvin, että ihmiset eivät ole Vero-soluja, sanoo Tarja Sironen.

Vero-soluja käytetään yleisesti soluviljelmissä, myös näissä SARS-CoV-2-tutkimuksissa. Nimi on lyhenne sanoista, jotka tarkoittavat vihreää munuaista, koska solut ovat peräisin vihermarakatin munuaisista.

SARS-CoV-2:stä tiedetään, että se alkaa soluviljelmässä adaptoitua hyvin nopeasti, Sironen kertoo.

– Se on siinä mielessä hyvin jännittävä virus. Se lähtee todella nopeasti adaptoitumaan uuteen eläinlajiin, olipa se sitten solumalli tai kokonainen eläin.

SARS-CoC-2-virukset valloillaan Vero-solujen joukossa. Elektronimikroskoopin kuvassa virukset on väritetty oransseiksi ja Vero-solut vaaleansinisiksi. NIAID

Eri puolilla maailmaa tehdyt sekvensoinnit osoittavat, että tutkimuksissa raportoitu piikkiproteiinin mutaatio on tosiaan yleistynyt voimakkaasti. Siitä voisi ehkä päätellä, että se leviää tehokkaasti, Tarja Sironen tuumii.

– On myös hieman potilasaineistoa, jonka perusteella voisi ehkä väittää, että uuden mutaation saaneissa potilaissa on muita suurempi virusmäärä. Mutta aineistot ovat hyvin pieniä, ja kysymysmerkkejä on paljon.

Mutaation vaikutuksesta taudin vakavuuteen ei sen sijaan ole lainkaan näyttöä. Olipa variantti kumpi tahansa, taudin vakavuus on samanlainen, Sironen korostaa.

– Taudin mahdollisesti herkempi leviäminen yksilöstä toiseen onkin sitten hankalampi kysymys. Sen voisi oikeastaan testata vain eläinmallissa. Jossakin eläinpopulaatiossa infektoitaisiin yksi yksilö kummallakin variantilla ja seurattaisiin, leviääkö jompikumpi toista tehokkaammin. Sellaista ei ole tehty.

Juuri nyt se ei edes ole prioriteetti, vaan tärkeämpää on testata rokotteita ja muita lääkeaineita, Sironen lisää.

Valtava aineisto, mutta ei kaikkialta

SARS-CoV-2:n genomi on avattu kymmeniätuhansia kertoja. Tarja Sironen kertoo, että hänen viime katsomallaan koko sekvenssejä oli jo yli 80 000.

– Kun vertaa vaikka myyräkuumevirukseen, jota olen aikaisemmin tutkinut, niin sen kokonaisia genomeja tunnetaan joitakin kymmeniä kaikkien näiden vuosien jälkeen, Sironen nauraa.

Sekvensointi ei hyödytä vain taudin leviämisreittien jäljittämisessä, vaan antaa tärkeää tietoa sekä rokotteen ja lääkkeen kehittäjille että diagnostiikalle. Nyt on jo nähty, että mutaatiot keskittyvät genomissa tietyille alueille.

PCR-testi, joka on diagnostiikassa tärkein nyt ja Sirosen mukaan varmasti jatkossakin, perustuu viruksen sekvenssiin, hän muistuttaa.

– Jos virus muuntuu niin, ettei testi tunnistakaan sitä, se huomataan sekvenssiä seuraamalla. Silloin pystytään kehittämään testiä niin, että se pysyy hyvänä ja herkkänä.

Valtava sekvensointimäärä ei silti tarkoita, että viruskanta oli tuttu kaikkialta maailmasta.

– Sekvenssiaineisto on tosi vääristynyt. Esimerkiksi Englannissa on ollut valtava projekti, josta on saatu tuhansia sekvenssejä, mutta monista muista maista niitä on vain kourallinen. Sekin pitäisi tutkijoitten muistaa.

Apulaisprofessori Tarja SironenPekka Koli / Yle

Tarja Sironen tekee työssään paljon sekvenssi- ja mutaationalyyseja ja sanoo, että SARS-CoV-2:sta tulee tällä hetkellä hyvinkin ala-arvoisia julkaisuja.

– Niitä sitten vedetään pois. Se on harmillista.

Yleensä tiede on yhteispeliä, jossa toiset tutkijat arvioivat tuloksia ennen niiden julkaisua.

– Nyt on sellainen tilanne, että kaikki koronatutkijat ovat kiireisiä ja vertaisarvioinnitkin tehdään vähän sinne päin. Julkaisuun asti pääsee hyvin kyseenalaista materiaalia, ja tuntuu, että joka tasolla on kiire saada julkaisuja ulos.

Tässä tilanteessa julkaistaan normaalia enemmän myös niin sanottuja preprinttejä, vertaisarvioimattomia versiota. Jokainen tutkija on varmasti nyt oppinut katsomaan niitä uusin silmin, sanoo Tarja Sironen.

– Aluksi ne olivat hyviä, mutta tällä hetkellä ehkä yksi 50:stä on OK.

SARS-CoV-2 on ainutlaatuinen hyppääjä

Mikä tekee SARS-CoV-2:sta niin perin vakaan? Päätyikö virus ihmisiin jostakin syystä niin valmiina, ettei muutoksille kerta kaikkiaan ole enää tarvetta?

Sellaistakin on puntaroitu, että virus olisi kiertänyt Kiinassa jo hyvän aikaa aiheuttamatta isoa tartuntarypästä ja ehtinyt matkansa varrella kehittyä omalta kannaltaan parhaimmilleen.

Apulaisprofessori Tarja Sironen vastaa evoluutiobiologian termillä "fitness landscape". Sen mukaan viruksella tosiaan on kehityshuippunsa, jonka jälkeen kaikki mutaatiot heikentävät sitä. Silloin kaikki heikommat variantit häviävät ja virus pysyy stabiilina.

– Ihan hiljattain tuli tosi hyvä julkaisu nimenomaan tämän viruksen alkuperästä mielestäni maailman parhailta virusevoluution tutkijoilta. He olivat sitä mieltä, että virus on kiertänyt hyvin samanlaisena jo kymmeniä vuosia lepakoissa, Sironen kertoo.

Pieni muutos piikkiproteiinissa riitti antamaan virukselle kyvyn tarttua tehokkaasti myös ihmiseen ja ihmisestä toiseen.

– Tämähän on aivan ainutlaatuinen virus siinä suhteessa, että se tosiaan pystyy hyppäämään hyvin moneen eläinlajiin.

Minkkitilalla Ospelissa Hollannssa COVID-19-tartunnan takia tapettuja minkkejä. Ihmisen tavoin minkkikin voi olla oireeton tai sairastua vakavasti, muun muassa keuhkokuumeeseen.Rob Engelaar / EPA

Useilla hollantilaisilla minkkitiloilla virus ei ole tarttunut ainoastaan ihmisistä minkkeihin vaan myös minkeistä takaisin ihmisiin.

– Eihän mikään muu virus tällaiseen pysty! Yleensä lajihyppäystä pidetään viruksille pullonkaulana, mutta tälle se ei ole vaikeaa, sanoo Sironen.

Kyky lajihyppäykseen on havaittu tyypilliseksi muillekin koronaviruksille, mutta ei missään tapauksessa samassa määrin kuin SARS-CoV-2:lle, hän lisää.

Entä hyppäsikö SARS-CoV-2 lepakosta suoraan ihmiseen vai oliko sillä väli-isäntänä jokin eläin, kuten muilla koronaviruksilla, joita ihmisiin on tarttunut?

– Vastaus löytyy vain viruksen syntysijoilta, ja kiinalaiset tutkijat ovat ainoita, jotka sen voisivat meille kertoa. Nyt vain odotellaan, mitä sieltä löytyy, sanoo Tarja Sironen.

Mutaatioiden hitaus on etu rokotteelle

Koronaviruksen käytöstä ei voi ennakoida influenssavirusten perusteella, vaikka monet oireet ovat samanlaiset. Mutaatiotaipumuksessa ja siksi myös mutaatiovauhdissa on iso ero.

– Influenssaviruksella genomi on kahdeksassa palasessa. Sen lisäksi, että virus muuttaisi yhden kohdan, se voi muuttaa kokonaisen palasen kerrallaan. Siksi se saattaa ottaa valtavia harppauksia kerralla, selittää Tarja Sironen.

HI-virus puolestaan on yksi kaikkein nopeimmin muuntuvista viruksista. Siihen ei ole pystytty kehittämään rokotetta, ja lääkkeitäkin on pitänyt kehittää jo lukuisia.

– Olen lukenut sellaisen arvion, että hiv-potilaan elimistöstä löytyvät viruksen kaikki mahdolliset mutaatiot joka hetki. Kaikki variaatiot ovat valmiina. Jokin niistä pärjää lääkettäkin vastaan.

Näihin viruksiin verrattuna COVID-19-rokotteen kehittäjillä on paljon pehmeämpi pala purtavana. Kunhan toimiva rokote saadaan, virus ei siltä heti karkaa.

Oxfordin yliopiston ja AstraZeneca-lääkeyrityksen COVID-19-rokotetta pidetään ehkä lupaavimpana. Sen ihmiskokeet keskeytettiin tällä viikolla, kunnes selviää, liittyykö yhden testatun sairastuminen rokotteeseen. Tässä rokotetaan vapaaehtoista Sowetossa Etelä-Afrikassa kesäkuussa. Siphiwe Sibeko / EPA

Tällä huimalla panostukselle, jota rokotteen kehittelyyn nyt pannaan, rokote varmasti onnistuu, sanoo Sironen. Hän kuitenkin lisää, että vasta aika näyttää, kuinka pitkän suojan rokote antaa. Ehkä rokotus pitää uusia joka vuosi, kuten influenssoja vastaan.

Entä lääke? Siitä on puhuttu paljon vähemmän.

– Remdesiviiristä on vahvin näyttö siitä, että se ainakin jonkin verran lievittää oireita. Mutta on ihan totta, että vaikka solumallissa on testattu valtava määrä erilaisia molekyylejä, niin aika harva on edennyt eläinkokeisiin tai tuottanut niissä hyviä tuloksia, kertoo Sironen.

Realismin nimissä hän muistuttaa, että viruslääkkeiden kehittäminen on yleensäkin haastavaa. Virukset käyttävät lisääntymiseen isäntälajin soluja, ja lääke pitäisi pystyä kohdistamaan niin, ettei virusta nujerrettaessa tapeta myös solua.

SARS-CoV-2:lla kaikki osui kohdalleen

Evoluutiossa käy usein myös niin, että viruksen ja isäntälajin välille löytyy tasapaino. Eihän viruksen kannata isäntäänsä tappaa. Voi olla hyvinkin mahdollista, että myös COVID-19 muuttuu aikaa myöten vähemmän vakavaksi infektioksi, sanoo apulaisprofessori Tarja Sironen.

– Sellainenkin hypoteesi on esitetty, että myös neljä nuhakuumetta aiheuttavaa kausikoronaa olisivat aikoinaan aiheuttaneet jonkinlaisen epidemian tai pandemian ja pikku hiljaa muuntuneet heikommiksi.

Se jää hypoteesiksi, koska nykyisenlaista virustutkimusta ei ollut, kun kausikoronavirukset hyppäsivät ihmiseen.

Toisin kuin ihmiset, lepakot ovat tulleet ikiaikoja sairastumatta toimeen koronavirusten kanssa. Tämä Kiinassa käyneen skottilaisen eläintutkijan John Andersonin piirtämä villaturkkiherkko vuodelta 1878 on lähisukua aasianherkolle, josta monet tutkijat arvelevat SARS-CoV-2-viruksen päätyneen ihmiseen.The History Collection / Alamy / AOP

Kansainvälisen Eco-Health Alliance -järjestön vasta-ainetestit, joita se teki Kiinassa ennen COVID-19:n ilmaantumista, osoittivat muidenkin koronavirusten kokeilevan, olisiko ihmisestä isännäksi.

400 lounaiskiinalaiselle tehdyissä testeissä kuuden verestä löytyi muisto todennäköisesti lepakoilta saadusta mutta tuntemattomaksi jääneestä koronataudista.

– Sitten tuli virus, jonka näkökulmasta kaikki osui kohdalleen. Se onkin sitten iso tutkimuskysymys, mikä oli ratkaiseva tekijä, vai oliko tämä vain sattumaa, sanoo Tarja Sironen.

Sitä hän ei ryhdy ennustamaan, milloin COVID-19 mahdollisesti asettuu lieväoireiseksi taudiksi. Mutaatioiden hitaus ei siinä suhteessa olekaan etu.

– Genomia katsoessamme osaamme vielä valitettavan huonosti ennustaa, tarkoittaako esimerkiksi jonkin aminohapon muuttuminen viruksen biologisten ominaisuuksien muuttumista. Siksi on mahdoton ennustaa, kuinka kauan tässä vielä menee.

Voit keskustella tästä aiheesta lauantaihin kello 23:een saakka.

Lue myös:

Täältä voit lukea kaikki tuoreimmat uutiset koronaviruksesta.

Koronalääkkeitä on ollut helpompi määrätä kuin tutkia – suomalaisprofessorin mukaan myyntilupia on annettu liian vähäisillä tiedoilla

Sumuista, sohjoista ja uskomattoman kaunista, kuvailee suomalaistutkija kesäänsä – Jäämerellä ajelehtivalla laivalla kerätään tietoa ilmastonmuutoksesta

Thu, 10/09/2020 - 10:41

Jäämerellä pikku hiljaa sulavan jäälautan mukana ajelehtiva tutkimusalus, seitsenpäiväiset työviikot, kontti työhuoneena, päivänvaloa kellon ympäri ja naapureina useita uteliaita jääkarhuja.

Sellainen työpaikka oli viime kesän ajan Helsingin yliopiston Ilmakehätieteiden keskuksen tutkimuskoordinaattorilla Tuija Jokisella.

Kansainvälinen MOSAiC-hanke on poikkeuksellisen laaja ja monitieteellinen. Tutkijoilla on omat alansa, mutta hankkeessa on keskeistä myös se, miten meri, jää ja ilma juttelevat keskenään arktisella alueella, jossa ilmasto on lämmennyt nopeammin kuin missään muualla.

Jokisen työtä oli ilmakehän reaktioiden seuraaminen.

– Meillä oli aluksen keulassa merikontti. Siinä oli 23 erilaista mittalaitetta, joita minä pidin yllä ja huolsin ja hoivasin, hän kertoo juuri päättyneestä työrupeamastaan.

Tuija Jokisen kädessä on pienhiukkasnäyte, jonka hän säilöi pakastimeen odottamaan pääsyä maihin ja analyysiin. Hän työskenteli valtaosin laivan laboratoriossa... Lianna Nixon ..mutta päiviä jäällä hän kehuu parhaiksi. Jokinen auttoi vapaaehtoisena muita tutkijoita muun muassa jäänäytteiden poraamisessa. Kun kesä lopulta hajotti jäälautan täysin ja laitteet piti saada sieltä nopeasti turvaan, hän ajoi moottorikelkkaa. Lianna Nixon

Arktiksen jääalueilla on tehty varsin vähän ilmastomittauksia. Ne ovat keskittyneet maalla sijaitseville asemille – Grönlantiin, Huippuvuorille ja Siperiaan, Tuija Jokinen kertoo.

– Ja näitä mittauksia, mitä me menimme sinne tekemään, ei ole tehty ollenkaan.

Esimerkiksi hivenkaasumittauksista saatiin todella paljon erittäin hyvälaatuista dataa, hän kertoo. Yhtenä havaintona hän kertoo sen, miten jääpeitto näyttää estävän rajan tavoin kaasujen pääsyä vedestä ilmaan.

Jää on kuitenkin hyvin dynaamista. Se liikkuu, siihen tulee railoja, ja aina kun kattavaan jääpeitteeseen syntyy railo, vedestä pääsee ilmakehään selvästi jotakin, joka hapettuu ja pystyy muodostamaan pienhiukkasia, Jokinen kertoo.

– Sen me näimme useita kertoja.

Ilmastonmuutoksen ymmärtämisen kannalta havainto on tärkeä.

– Jos vesi on emissiolähde pilvipisaroita muodostaville yhdisteille ja jäätä on yhä vähemmän, sillä on iso merkitys. Kattava ja iso jääpeite pitää nämä mahdolliset emissiolähteet piilossa. Jos jääpeite sulaa, merkitys on todella suuri, Jokinen sanoo.

MOSAiC = Multidisciplinary drifting Observatory for the Study of Arctic Climate, "monitieteellinen ajelehtiva tutkimusasema arktisen ilmaston tutkimiseksi"

Satojen tutkijoiden ja muun henkilöstön monijaksoinen MOSAiC-hanke maailman laidalla ei ollut logistiikaltaan alkujaankaan mikään pikkujuttu. Ja sitten iski koronapandemia.

Sen takia matkaan tuli monta mutkaa, joiden vuoksi ei ollut lainkaan varmaa, että Polarstern-alukselle keväällä menneet pääsisivät palaamaan kotiin ja uudet tutkijat ja muut työntekijät voitaisiin viedä heidän sijalleen.

Polarsternille piti matkustaa jäänmurtajalla Huippuvuorilta, mutta kun Tuija Jokinen lähti Helsingistä vappuna, suuntana olikin Saksa, MOSAiC-hanketta johtavan Alfred Wegener -instituutin kotimaa.

Matkalaiset odottivat runsaat kaksi viikkoa hotellissa karanteenissa, kunnes löytyi laiva, jota ei huolettanut ottaa heitä kyytiinsä. Kaksi alusta oli jo perunut sopimuksen koronatilanteen vuoksi.

Ennen lähtöä koronatesti tehtiin kolmannen kerran, sillä viruksen pujahtaminen Polarsternille olisi ollut katastrofi.

– Vasta laivalla totesimme, että olimme oikeasti matkalla, ja meillä oli iso ryhmähalaus, Jokinen kertoo lähdöstä kohti Huippuvuoria.

Matka Huippuvuorille taittui lopulta saksalaisen merentutkimusalus Sonnen kyydissä. Tämä auringonlasku oli yksi viimeisistä, jotka Tuija Jokinen näki neljään kuukauteen. Tuija Jokinen

Polarsternin ajelehtivaksi satamaksi oli syystalvella etsitty kyllin suuri ja tukeva jäälautta, joka kykeni kannattelemaan tutkimusleiriä. Aluksen oli määrä pysytellä sen kyljessä, kunnes kesä hajottaisi lautan.

Liikenne Polarsternille ja takaisin piti hoitaa jäänmurtajilla. Uusi tilanne vaati uuden ratkaisun: tutkimusalus irrottautui jäälautasta ja tuli vastaan.

Välissä oli kuitenkin niin paljon ahtojäitä, että Polarsterniä oli odoteltava pari viikkoa Huippuvuorten vesillä.

– Sanotaanko, että olin kyllä aika merisairas sinä aikana, sanoo Tuija Jokinen vanhasta vaivastaan.

Polarsternin jääleirin sulamislammikot kastelivat niin jääkarhujen kuin välillä ihmistenkin jalat.Tuija Jokinen

Railojen rajaama jäälautta oli kesäkuussa hupenemassa hyvää vauhtia.

– Sieltä tulleet kolmannen osion tutkijat sanoivat, että "ei sinne kannata enää mennä, se on ihan sohjoa", kertoo Tuija Jokinen.

Hän pääsi näkemään lautan viimeiset vaiheet.

– Jäät liikkuivat niin paljon, että joinakin päivinä lautan vieressä oli satoja metrejä avovettä ja seuraavana päivänä railo oli taas kaventunut.

Reikiäkin lautassa jo oli. Muutamalta ihmiseltä meni jalka jäästä läpi, mutta kuivapuvussa heillä ei ollut vaaraa. Jotkut kävivät uimassa sulamislammikossa, Jokinen kertoo.

Heinäkuun lopussa jäälautta antoi periksi ja murskaantui palasiksi. Vielä edellisenä päivänä sieltä haettiin moottorikelkalla tavaraa pois, Jokinen kertoo.

– Seuraavana aamuna lautasta ei ollut jäljellä juuri mitään. Hyvästelimme sen, ja joimme kuohuviinit sen kunniaksi.

Pari viikkoa sen jälkeen alkoi paluumatka venäläisellä jäänmurtajalla. Polarstern sen sijaan lähti pohjoisnavan ohi hakemaan uutta kotilauttaa, sillä tutkimukset jatkuvat lokakuun puoliväliin saakka. Voit seurata Polarsternin ajantasaista ajelehtimista MOSAiCin verkkosivulla kartasta ja päiväkirjasta.

"Arktiksella on uskomattoman kaunista. Se oli pysäyttävä kokemus. Ja jään murtaminen on tosi siistiä hommaa! Jos en olisi niin merisairas, ehkä olisin harkinnut uraa jäänmurtajan kapteenina", naureskelee Jokinen. Tuija Jokinen

Jokinen ei ollut ensimmäistä kertaa erikoisissa työoloissa. Hänellä on kokemusta myös Grönlannista ja Etelämantereelta. Arktiksella työt tosin venyivät pisimmiksi. Nyt jo vähän toivoisi pääsevänsä toimistolle paperitöihin, hän nauraa.

– Tuloksia on niin paljon, ja ne ovat niin mielenkiintoisia, että vähän jo kutkuttaisi päästä niiden pariin.

Helsingin syyskuinen hämärä hämmentää elimistöä, joka ehti tulla siihen tulokseen, että yötä ei ole olemassakaan. Polarsternillä päivää rytmittivät Auringon sijasta tarkat ruokailuajat. Etelämantereen kokemusten takia Jokinen oli varautunut unettomuuteen.

– Etelämantereella sisäinen kelloni heitti aivan häränpyllyä. En tiennyt yhtään, oliko päivä vai yö, paitsi siitä, mistä ikkunasta Aurinko paistoi. Arktiksella ajattelin, että nukun silloin, kun väsyttää, olipa sitten päivä tai yö. Pärjäsin päiväunilla.

Polarsternille päästyään Tuija Jokinen näki pian ensimmäisen jääkarhun ja sen poikasen. Pentu oli niin ruipelo, että sen täytyi olla vielä hyvin nuori, Jokinen arvioi. Tuija Jokinen

Yksi asia, johon Arktikselle matkustavien piti varautua, olivat isot ja uteliaat naapurit. Jääkarhujen varalta oli osattava käyttää asetta.

Tuija Jokiselle aseen kantaminen oli ennestään tuttua, sillä Grönlannissakaan tutkimusasemalle ei saa lähteä ilman kivääriä. Tällä kertaa hän ei ollut aseistettu karhuvahti, mutta tarkkaili laivan komentosillalta usein kiikarilla, mitä jääkarhuilla mahtoi olla mielessään.

– Karhuja siellä kyllä näki aika paljon. Esimerkiksi loppuaikoina meillä oli viikon verran joka päivä karhu joko ihan laivan vieressä tai niin, että komentosillalta näkyi, että se oli nukkumassa meidän jäälauttamme vieressä.

Näkyvyyden perusteella päätettiin, pystyttiinkö kyllin hyvin seuraamaan, koska karhu herää ja mihin se lähtee, eli uskallettaisiinko päästää ihmiset jäälle töihin. Päivät olivat enimmäkseen sumuisia, Jokinen kertoo.

– Siellä oli paljon myös emokarhuja poikasten kanssa. Silloin karhuja ei ollutkaan yksi, vaan niitä saattoi olla kolme, ja perässä saattoi seurata vielä uroskarhukin aika samoja jälkiä.

Polarstern väkineen on kiinnostanut paikallisia asukkeja koko hankkeen ajan. Aseistettujen karhuvahtien tehtävänä on varmistaa, ettei kiinnostus tuo karhuja liian lähelle jäälautalla työskenteleviä ihmisiä. Tuija Jokinen Kun jääkarhun jälkiä kävi katsomassa, niin tassu oli kyllä ollut aikamoinen omaan kenkään verrattuna, kertoo Helsinkiin palannut Tuija Jokinen esitellessään karhukuviaan. Markku Pitkänen / Yle

Jääkarhujen, hylkeiden ja valaiden lisäksi polarsterniläiset bongailivat lintuja. Tällä matkalla Tuija Jokinen sai kuulla niistä jotakin, joka oli ilmaston tutkijalle erityisen kiinnostavaa.

– Yksi karhuvahdeista oli varsinaiselta ammatiltaan lintuja tutkiva biologi. Hän kertoi, miten ne löytävät ruokaa haistamalla dimetyylisulfidia, jota mekin mittasimme ilmakehästä. Ne ovat siis vähän niin kuin meidän mittalaitteemme!

Sen tajuttuaan Jokinen tähysteli erityisen innostuneesti, missä lintuja mahtoi lentää.

Myös valaat haistavat samoja rikkiyhdisteitä, jotka kertovat, että lähistöllä saattaa olla jotakin orgaanista eli syötävää.

Tuija Jokinen näki matkallaan paljon lahtivalaita. Ne eivät epäröineet uida jopa railoissa. Tuija Jokinen

Ei vain biologeille vaan myös ilmakehäntutkijoille merkittävää on myös leväkasvusto, joka on Jäämerellä varsinkin kesäkuukausina metrien mittaista.

Juuri levästä erittyy rikkiyhdisteitä ja todennäköisesti myös jodiyhdisteitä, halogeenejä, jotka voivat ilmakehään päästessään vaikuttaa sen kemiaan, Jokinen kertoo.

Hän jututti biologeja heidän kemiallisista levätutkimuksistaan selvittääkseen, mikä levä erittää jotakin tiettyä yhdistettä, joka voi vaikuttaa esimerkiksi pilvipisaroiden muodostukseen.

– Jos Arktiksella muodostuu pilvipisaroita, se vaikuttaa vedenkiertoon. On mielettömän hienoa, että tutkijat saadaan samaan paikkaan samaan aikaan ja voidaan linkittää nämä asiat, eivätkä kaikki tee erikseen biologiaa ja kemiaa ja ilmakehätiedettä.

Myöskään arjessa tavallinen asia, sääennusteet, ei ole kaikesta tästä irrallinen palikka. Ilmastotutkimus luo niitä varten perustietoa esimerkiksi siitä, miten yhdisteet hapettuvat ilmakehässä, miten niistä tulee pienhiukkasia ja miten ne puolestaan vaikuttavat pilvisyyteen.

– Jos kaikki nämä prosessit tunnetaan hyvin, niin totta kai ennustukset paranevat, koska niitä pystytään silloin mallintamaan, Jokinen sanoo.

MOSAiC-hankkeessa on mukana 20 maata. Ilmakehätiimillä on mittalaitteita paitsi laivalla ja jäällä, niin myös drooneissa ja pienissä miehittämättömissä lentokoneissa.Lianna Nixon

Mielenkiintoinen kesä Jäämerellä on takana. Mitä tutkija ryhtyy tekemään, kunhan on lakannut nukkumasta makeasti päivällä ja valvomasta yöllä, kuten hänelle on palattuaan käynyt?

Hivenkaasupitoisuudet, aerosolihiukkasia muodostavat yhdisteet, ovat sydäntä lähellä, Tuija Jokinen vastaa. Niistä saatua dataa hän aikoo ryhtyä analysoimaan välittömästi.

Samalla hän käsittelee tuloksia sellaiseen muotoon, että ne ovat myös muiden tutkijoiden käytettävissä.

MOSAiC-hankkeen kaikki mittaustulokset on määrä julkaista parin vuoden päästä esikäsiteltyinä koko tiedeyhteisön hyödynnettäviksi ilmastonmuutoksen vastaisessa taistelussa.

Tyypillinen sää, kommentoi Jokinen tätä kuvaansa.Tuija Jokinen

Antarktiksen ilmasto lämpenee kaksinkertaista vauhtia maapallon keskiarvoon verrattuna. Samalla Pohjoisen jäämeren jääpeite hupenee vuosi vuodelta.

Pohjoisimmatkin alueet lainehtivat sulina vuoteen 2035 mennessä, ennustaa Nature Climate Change -lehdessä viime kuussa julkaisu brittiläis-kanadalainen tutkimus, eikä ole varoituksessaan ainoa.

Siihen on vain viisitoista vuotta aikaa. Onko peli siis jo menetetty? Kannattaako enää tutkiakaan? Totta kai kannattaa, vastaa Tuija Jokinen.

MOSAiC-hankkeen mittaustuloksia voidaan käyttää ilmastomalleissa kuvaamaan esiteollista aikaa, jolloin ihmisen vaikutus ilmastoon oli vähäistä. Pohjatieto on tarpeen ilmastomallien luomisessa.

– Luonnontilaisia paikkoja, joissa esiteollista aikaa pystytään kokeellisesti tutkimaan, on enää hyvin vähän, vain Etelämantereella ja juuri Arktiksella. Tärkeää on myös muutoksista saatava tieto.

Kun on tietoa, voidaan ehkä jotakin tehdäkin, jos poliittista tahtoa riittää.

Voit keskustella tästä aiheesta perjantaihin kello 23:een saakka.

Lue myös jäätutkijan talvisesta työrupeamasta:

"Se oli upeaa!" Tutkimusprofessori Jari Haapalan oli ulkotöissä Arktiksen pakkasessa ja pimeistä pimeimmässä kaamoksessa.

"Polastern oli majakka, joka ei päästänyt eksymään jääkentällä."Stefan Hendricks / Alfred Wegener -instituutti

Pages